Sparkling Nebbiolo and Nebbiolo Bianco - Piemonte and Lombardy, Italy

At some point in the next few hours, Fringe Wine will pass the 50,000 page view mark.  When I first started writing this blog, I had no idea if anyone would care about these grapes and wines and, further, I didn't know if anybody would care what I had to say about them.  The first full month that the blog was online I got a total of 21 pageviews.  The next month was somehow worse as there was only  a total of 20 pageviews.  I kept plugging away at it and slowly but surely traffic started to rise.  It has taken 19 months to get to 50,000 views, but if traffic holds steady, it will only take about another 7 to get 50,000 more (and if it continues to increase as it has, we'll get there in about half that time).  I've learned so much in the course of writing this blog and have gotten to meet many interesting and amazing people.  I'm blown away every day to see how many people are reading the things that I've written and am grateful to everyone who takes the time to check it out.

In celebration of reaching this milestone I'd like to write about a couple of really interesting wines I've had recently that were made from the Nebbiolo grape.  Nebbiolo is one of the world's great grapes, forming the base of two of the world's most spectacular wines, Barolo and Barbaresco.  I wouldn't ordinarily write about wines made from it, but these two wines were made in very unique styles.  One of them was a white table wine, similar in style to the Blanc de Franc I took at look at a few months back, while the other was a fully sparkling metodo classico rosé wine made by four young winemakers in Piemonte who became friends while attending oenology school together.  But before we get to those wines, let's take a look at the Nebbiolo grape and see if we can learn a bit more about it.

Nebbiolo's name is thought to come from the Italian word nebbia, which means fog and is a reference to the dense fog that tends to form in the Langhe river around harvest time each year.  To be as widely esteemed as it is, plantings of Nebbiolo are shockingly low and not geographically widespread at all.  It is planted on only about 5,000 hectares (about 12,700 acres) of land, which places it well outside of the top 20 most widely planted grapes in Italy (Aglianico sits at number 20 with just over 18,000 acres planted as of 2000).  For comparison's sake, Catarratto is planted on over 100,000 acres of land in Italy, but you'd have a much more difficult time finding a wine made from Catarratto at your local wineshop than you would one from Nebbiolo.  Nebbiolo is planted almost exclusively in northwestern Italy in various parts of Piemonte, the Valle d'Aosta and Lombardia.  There are plantings scattered in other areas of the world, but the grape just doesn't seem to do well outside of very selected areas in Italy.  It is a unique grape in that it seems to perform well in a few very specific, very small places and nowhere else.  Of all of the great wine grapes in the world, Nebbiolo is far and away the most scarce and prices for the best wines made from it definitely show it.

There are three main Nebbiolo clones that make up most of the plantings of the grape: Lampia, Michet and Rosé.  Nebbiolo Lampia is the most common of the three and is the vine we are generally referring to when we talk about Nebbiolo.  The Nebbiolo vine is particularly susceptible to viral infections and Nebbiolo Michet is essentially a Nebbiolo Lampia vine that has been infected with a particular virus which causes the vine's canes to fork.  In a presentation (link is currently dead...similar paper can be found here, in Italian) given at the Nebbiolo Grapes conference in 2004 (in Italian), a team of scientists reported that Nebbiolo Rosé is actually a genetically distinct variety, though it does have a parent-offspring relationship with Nebbiolo Lampia (though we don't know which way the arrow is pointing).  This team also found that Nebbiolo Lampia was very closely related to Freisa and to Vespolina, among a handful of other Piemontese obscuranda.  Decanter filed a report based on this presentation later that year where they claim that Nebbiolo is related to Viognier, though close reading of the article shows that they are overstating the case.  Since Freisa is related to Nebbiolo, then grapes that Freisa are related to are also grapes that Nebbiolo is related to.  The research team found that Freisa had a lot of genetic similarities to Viognier, but they stopped short of saying that there was any provable familial relationship and I've not been able to find any publications since that time which were able to comment on the case with any certainty.  It seems likely that there's some kind of relationship, but we just don't have enough evidence at this point to say one way or the other.

The first of the two wines that I'd like to talk about was the 2010 Pietro Nera "La Novella" from the Terrazze Retiche di Sondrio IGT, which I believe is in the Valtellina area of Lombardia.  The wine is made from 80% Nebbiolo and 20% Chardonnay and, as mentioned above, is a white wine.  I picked this bottle up from my friends at the Gypsy Kitchen for about $21.  In the glass the wine was a very pale silvery lemon color with some greenish tints to it.  The nose was moderately intense with aromas of pears and ripe red apples.  On the palate the wine was on the lighter side of medium with high acidity.  There were flavors of green apple and meyer lemon with some ripe pear and white peach.  It was sharp and zippy but had a bitter, pithy kind of finish.  From the nose you'd expect a broad, ripe flavor profile, but it's actually fairly lean and little bit tart.  It's a really cool wine and it's good, but the price is a little high for what you get.  It's an interesting novelty but it's hard to imagine buying a case of something like this.

The second wine that I tried was the 2006 Erpacrife sparkling Nebbiolo which I picked up from my friends at the Wine Bottega for $75.  This wine is made by four young winemakers who met in oenology school and decided to make a sparkling Nebbiolo for their thesis project.  They continued to make it after they graduated by using the fruit from some of the younger Nebbiolo vines on their properties.  The name "Erpacrife" is a combination of the first syllable of each of their names: Erik, Paolo, Cristian and Federico.  It's a traditional method sparkler with no added dosage.  In the glass this wine was a medium pink color with vigorous bubble.  The nose was strikingly intense with candied strawberry and rose petal aromas.  On the palate the wine was light bodied with very high acid and intense bubbles.  The flavor was very floral with rosewater, dried strawberries and something a little bit tarry.  There wasn't a great deal of depth to the wine but the flavors were pure and intense.  $75 is a lot of money to pay for wine but this was so unique and so tasty that I wouldn't have any problem at all paying that amount again for another bottle.  It's really just a fantastic wine.

Favorita and DNA Microsatellite Analysis - La Morra, Piemonte, Italy

What is one to do with a grape like Favorita?  According to the Italian wine authorities, Favorita is a distinct grape variety, but according to the scientists, it is genetically identical to both Vermentino and Pigato.  What are those of us who are fanatical about classification to do with Favorita, Pigato and Vermentino?

Those of you who are familiar with this blog are aware that this is an issue that has caused me to spill a considerable amount of ink.  My most complete treatment of the issue can be found in the Roter Traminer article, though I do touch on the issue in my Malvasia Nera post as well as my Pigato post.  The question I'm wrestling with in all of those posts concerns the point at which a clonal variant becomes differentiated enough to be considered a separate grape variety.  Where do we draw that line?  How different is different enough to be considered separate?

Believe it or not, this question was actually much easier to answer before the arrival and widespread use of DNA testing for grapes.  Ampelography was (and technically still is, I suppose, though there are precious few ampelographers in the traditional sense of the word anymore) the science of grapevine identification and differentiation using the physical characteristics of the vine itself.  Leaf shape and size was perhaps the most widely used measure for ampelographers, but other factors such as grape size and color and bunch size and shape were used not only to identify unknown vines in the vineyard but also to differentiate grape varieties from one another.  This was not a perfect system by any means and there have been some fairly famous gaffes made by ampelographers in the past (like the mistaking of Carmenere with Merlot or of Sauvignon Blanc with Friulano in Chile, for example, though to be fair both of those cases were also eventually sorted out by ampelographers), but there's a certain kind of elegance and intuitive sense to classifying plants this way.

The areas where ampelography has been found the most wanting, especially in recent years, concern those cases of vines that are likely clonally descended from a common ancestor, but which have been spread out geographically over a long period of time and have developed mutations along the way. All of the mutations that happen to grapevines which have an effect on the physical appearance of the plant are called somatic mutations.  These mutations can affect everything from leaf shape to bunch size to grape size.  Some are subtle while others are dramatic, though most of the dramatic mutations probably started out subtle and were exaggerated over time through clonal selection.  The most famous somatic mutations involve Pinot Noir and its tendency to mutate into vines that produce white berries, which are known as Pinot Blanc, or pink berries, which are known as Pinot Gris.  These somatic mutations cannot be picked up with current DNA analysis techniques because those techniques do not analyze the entire DNA string of a grape.  I've mentioned DNA analysis enough on this site that I really should take some time to try to explain exactly what it is and how it works so buckle up because there's some serious science ahead.

As I'm sure you already know, DNA is one of the basic building blocks of life.  It is composed of two strands of molecules which run parallel (technically anti-parallel, but let's not quibble) to one another in a twisting design known as the double helix.  These strands are made up of four different nucleobases, each of which has its own unique partner on the opposite strand that it is connected to by sugar or phosphate molecules.  The nucleobases are Guanine (G) which pairs with Cytosine (C) and Adenine (A) which pairs with Thymine (T).   Some of the arrangements of nucleobases are involved in synthesizing proteins, and these areas are known as genes, but some of the sections of DNA are just filler or what I like to call Junk DNA.  It turns out that there are a lot of Junk DNA sites throughout the entire DNA sequence of an organism, but the ones that we're interested in are called microsatellite sequences. Microsatellite sequences are repetitions of between one and six nucelobases that are scattered randomly throughout an organism's DNA.  So a typical bit of DNA might look something like this:

...CATGTACGGATACTCACCTAGAGAGAGAGAGAGAGAGAGTACAATGC...

That bit in the middle where AG repeats is a microsatellite site, and it turns out that there are between 1,000 and 10,000 of these sites scattered throughout the genomes of most complex multi-cellular organisms (not all of them are repeats of just two nucleobases...it could just be one [AAAAAAAA] or as many as six [GATCACGATCACGATCACGATCAC]).  It also turns out that some of these sites are highly variable between individuals and are inherited in very specific ways.  What scientists have done is to find where these sites are in humans as well as in grapes and they have pinpointed the areas that are the most variable between individuals.  These sites are given names like VVS1, ZAG64, and VVMD28 among others and they are the regions that scientists look at when they are trying to differentiate between different grape varieties or confirm synonymities between differently named grapes that are genetically identical.  All individuals have microsatellite sites in the same places on their genome, but the size of the site will be different between individuals, so the number of base pairs in the repeat are counted up and compared across subjects to see which are identical and which are different (this is not very important in humans because humans are obviously distinctive from one another and are not propagated clonally as grapes are...see my Ciliegiolo post for a discussion of this issue).  Most studies use between 6 and 10 different microsatellite sites in their analyses in order to differentiate between individual varieties because fewer sites don't give enough discriminatory power while more sites don't give you any added benefit.  Parentage studies use the same technique, but look at different microsatellite sites which have been found to be directly inherited from each parent.  This is the same technology, incidentally, used in paternity tests in humans and made famous by such trash-talk heavyweights as Jerry Springer.

It's important to remember that these microsatellite sites are Junk DNA that are essentially just taking up space.  They don't encode for any proteins and don't have any effect on the physical appearance of the plant.  Remember for a moment what we said about somatic mutations: they are mutations that have an effect on the physical appearance of the plant, which means that they are mutations that occur in areas of the plant's DNA that are actually doing some kind of work.  The kinds of mutations that affect berry skin color are happening in areas of the plant's DNA outside of the areas that microsatellite site analysis is looking at, so these mutations are essentially undetectable with this kind of technology.  This can be a good thing, as it allows us to trace the clonal history of grapes like Pigato, Favorita and Vermentino, which are geographically dispersed, to a single grape ancestor, but it can also possibly lead us to overly reductionistic conclusions.  Pigato, Favorita and Vermentino are genetically identical according to the microsatellite analysis, but does that mean they're the same grape?

The case of Pinot Noir is significant here, I think.  Pinot Noir, Pinot Blanc and Pinot Gris are genetically identical, but are considered to be different grape varieties by virtually every expert on earth, while grapes like Nielluccio, Sangiovese and Prugnolo Gentile are considered to be clonal variants of the same grape, Sangiovese.  The difference in the two cases is obvious: the Pinot mutation has an obvious physical manifestation, namely the color of the grape skin.  But it's more than just that.  The color of the grape skin has a direct effect not only on the wines that are made from that grape, but also in the kinds of wines that can be made from it and the methods that one must employ to make those wines.  The physiological difference entails a different approach to making wines from that grape, while the physiological differences between the Sangiovese clones are much more subtle.  One could mistake wines made from the Sangiovese clones with one another while it would be much more difficult to make that mistake with wines made from the Pinot varieties.  

The situation with Pigato, Favorita and Vermentino is, unfortunately, not so clear cut.  There are obvious physical differences: Pigato has a characteristic splotchiness on the grape skins that Favorita and Vermentino lack while the leaves, clusters and buds of Favorita are different enough from those of Vermentino that the Italian Ministry of Agriculture decided that it was a separate grape in 1964, stating unequivocally that "Favorita and Vermentino must be considered as two distinct cultivars," but given the new information that DNA analysis has provided, can we still say the same thing today with the same amount of confidence?  The splotchiness of the skins of Pigato has no real effect on the wines made from the grape or on the range of wines that could possibly be made from it, and the physiological differences between Favorita and Vermentino seem to be merely cosmetic.  One could argue that wines made from each of the three grapes are distinctive from one another, but one would expect that anyway given the range of places and climates where each is primarily found (Pigato in Liguria, Vermentino in Sardinia and Liguria and Favorita in Piemonte).  Wines made from Chablis are much different from those made in Pugliny-Montrachet, for example, but Chardonnay is the grape in both wines.  

So what are we to do?  It would be ideal if the genomes of Pigato, Favorita and Vermentino were completely sequenced so that an analysis could be done to see where the differences are in their DNA and to see just how widespread they are.  We know that they're ultimately descended from the same plant and have mutated independently over time to the extent that they are visually distinguishable from one another, but we just don't know how significant the mutations have been on a molecular level and we can't know unless we have the entire DNA sequence of each grape.  Sequencing an individual grape variety is no small task, though, and I doubt seriously that there's much clamor for that kind of work on any of these three grapes. Given the standards that are currently used to differentiate grape varieties, I don't see any way to consider Pigato, Favorita and Vermentino as separate cultivars.  The differences just don't seem significant enough to me to merit differentiation.  If any readers have any thoughts, please share in the comments section as I'm very interested to see how others might feel about this (if anyone other than me ever thinks about this kind of stuff).

The grape we call Favorita is grown exclusively in Piemonte around the Roero region and is thought to have arrived in this area over 300 years ago via Ligurian oil merchants.  The grape is known for having large berries and has been a popular table grape in Piemonte for many years.  It is thought that moniker "Favorita" was bestowed as a result of its prowess and esteem as a table grape and not as a wine grape.  When it was used for wine, historically it was blended with Nebbiolo in an effort to smooth over some of Nebbiolo's rough edges.  Varietal wines made from Favorita have enjoyed some success recently, but plantings lag well behind those of Arneis and Chardonnay in the Langhe.  Many examples that we find here in the US are slightly spritzy, though I'm not sure how prevalent that style is elsewhere.

I was able to find a bottle of the 2009 Gianni Gagliardo "fallegro" Favorita at Bauer Wine and Spirits for about $17.  In the glass the wine was a medium lemon gold color.  The salesperson at Bauer told me this wine was supposed to be a little fizzy, but mine was completely flat.  The nose was a total blank with maybe a suggestion of lemon or apple, but it was really a total cipher.  This is apparently a characteristic of the grape itself, as Nicolas Belfrage in his Barolo to Valpolicella refers to the grape as "non-aromatic [with] any scented character it may have coming by illicit blending."  On the palate the wine was medium bodied with medium acidity.  It was somewhat cidery with ripe apple and apple peel fruit along with a touch of pear and melon as well.  The wine was bottled with a synthetic cork so I wonder if perhaps there was a faulty seal which may have caused my bottle to go flat and take on a bit of oxygen.  I haven't had a chance to try another Favorita-based wine, so I'm really not sure how representative my bottle is. This bottling is supposedly the benchmark for Favorita wines, but it didn't do much for me.  

Corvina - Veneto, Italy

Last week we took a look at the Xarel-lo grape and noted that while it wasn't all that uncommon to find a wine with Xarel-lo in the blend, it was fairly uncommon to find a wine made from 100% Xarel-lo.  Today's grape, Corvina, is very similar to Xarel-lo in that it is also generally found in a blend with at least two other grapes and is rarely found as a varietal wine.  Since I was able to track down and try one of those unusual wines I thought I'd take a few minutes to share some information about it.

Corvina is the main component in the red wines of Valpolicella and Bardolino in the western part of the Veneto region of northeastern Italy.  Both of those wines are generally made from a mixture of Corvina, Rondinella and Molinara grapes though other grapes like Rossignola, Negrara Trentina, Oseleta, Barbera, Sangiovese or Corvinone are also permitted.  Bardolino is south of Valpolicella on the eastern shore of Lake Garda and tends to make lighter bodied wines.  In Bardolino, Corvina is required to make up 35 to 65% of the total blend for all styles and subregions.

The table wines of Valpolicella are thought to be more intense and deeper than those of Bardolino and Corvina is required to make up between 40 and 70% of the Valpolicella and Valpolicella Classico table wines.  Rondinella is required to make up 20 to 40% of the blend and miscellaneous grapes are allowed to make up the difference (to a maximum of 15%).  Molinara used to be a requirement in the blend but was thrown out when the area was applying for DOCG status as Molinara is not considered to be a quality grape (only Amarone and Recioto della Valpolicella were ultimately granted DOCG status in 2009).  For the famous and powerful Amarone wines of Valpolicella, made from dried grapes, and for the Recioto wines, made from passing Valpolicella wine over the dried grape skins left over from Amarane production, Corvina must make up between 45 and 95% of the blend, Rondinella 5 to 30% and miscellaneous grapes up to 25%.

For many years there was a grape grown in the Valpolicella and Bardolino regions which was known as Corvinone because it was thought to be a large-berried mutation of a Corvina vine (Corvinone means essentially "big Corvina").  A study done in 2003 has shown that Corvinone is actually a distinct cultivar from Corvina, and, further, that Corvinone doesn't appear to be related to any of the other Veronese grapes that were analyzed in that study.  Many online sources indicate that Corvina has a parent/offspring relationship with Rondinella, but I haven't been able to find any specific study that corroborates that assertion.  Most sites are just cutting and pasting the text from the Wikipedia entry on Corvina, whose citation points to the Oxford Companion to Wine, whose entry reads "DNA profiling at San Michele All'Adige in 2005 supported a parent-offspring relationship with Rondinella."  Those of you who have been reading this site over the last few months are already well aware of my issues with the OCW and their treatment of these kinds of issues, so I'll abstain from another rant on the subject and will merely direct unfamiliar readers to these posts on Hondarrabi Zuri (part 1 and part 2), Emerald Riesling and Ciliegiolo for context and background.  I will say that I was unable to locate the study they are referring to from that description and so I really can't say what the relationship is between Corvina and Rondinella.

In his Barolo to Valpolicella, Nicolas Belfrage writes that references to a wine called Corvini appear as early as 1627, though it isn't clear whether this reference is to the modern Corvina.  The first specific written reference to the Corvina grape (also known as Corvina Veronese,  Cruina or Cassabria depending on where you are) occurred in 1818, so its history in this region can be traced back at least that far.  He quotes one modern grower as saying that "Corvina is a great grape variety with a great defect," which is that the first few buds on the cane do not produce any fruit, so the vines have to be trained long and given plenty of space, which means that they can't be planted very densely and thus yields per hectare are fairly low.  The skins of Corvina are very thick which not only makes it resistant to rot or fungal diseases in the vineyard, but also means that it can stand up to the drying process necessary to transform it into Amarone with little trouble.  In 2010, a team at Verona University were able to fully sequence Corvina's DNA, and what they found was that there were over 400 different genes in Corvina that activated when undergoing the drying process which are responsible for many of the unique flavors found in Amarone wines.  Some of these genes were present in other grapes such as Pinot Noir, but they do not activate when dried and so those flavor compounds are not created.

I was able to find a bottle of the 2009 Tenuta Sant'Antonio "Scaia" Corvina from my friends at Curtis Liquors for about $12. This bottle is an IGT because no DOC zone allows for a 100% Corvina wine.  I've come across a few different vintages of this wine and it seems like these guys like to change their label almost every year so whatever is available at your local shop may look much different from the picture at right.  In the glass the wine was a medium purple ruby.  The nose was moderately intense with red cherry, stewed berry and plum fruit with a touch of dry leather and espresso.  On the palate the wine was on the fuller side of medium with fairly high acidity and medium tannins.  There were strong cherry and red plum fruit with a bit of chocolate and spice. There was also a bit of dried cherry and espresso on the finish.  The wine was nicely balanced between juicy cherry fruit and earthy chocolate and coffee flavors.  Fans of Valpolicella or Bardolino will obviously find a lot to like here, and it should provide an interesting opportunity for aficionados of those regions to get a sense of what Corvina contributes to the blended final products there and what it is capable of on its own.

Xarel-lo - Penedès, Catalonia, Spain

Xarel-lo is one of those grapes that most wine drinkers have probably had at some point in their lives, though many of them may not be aware of it.  It is grown on over 20,000 acres of land, nearly all of them in Spain, and it forms the backbone of one of the most popular and widely available wines on earth, but few people are even aware it exists.  Xarel-lo is kind of the ultimate team player.  It is an indispensable component of the wine that it has helped to make famous but it still plugs along in virtual anonymity.  It's a yeoman grape that hasn't been given its due so let's take a moment and have a look at Xarel-lo and its charms.

Xarel-lo is one of the three traditional grapes used in the production of the Spanish traditional method sparkling wine known as Cava.  Cava is made in the same way as Champagne and at one time was known as Spanish Champagne, though that practice had to be abandoned when Spain joined the EU in 1986 (it is still known locally as champán, champaña or xampany depending on where you are in Spain).  The other two grapes are Parellada, which we'll get to in a future post, and Macabeo, which is perhaps better known as Viura, the great white grape of Rioja.  Most Cavas are blends of some or all of these grapes, but the producers aren't under any obligation to inform the consumers about which grapes are used and in what proportions.  Most Cava bottles that you'll find in your local shops are mute about the components of their blend and it seems that most consumers really aren't that worried about it.

Many wine enthusiasts are under the misapprehension that only Parellada, Macabeo and Xarel-lo are used in the production of Cava, but this is not the case.  Most of the Cava that is produced is made from these grapes, but there are other grapes that are allowed.  Chardonnay, Pinot Noir, Garnacha, Monastrell and Subirat (which may be some form of Malvasia) are permitted for the production of your basic white Cava.  There is also rosé Cava which is made by adding in some still red wine made from Pinot Noir, Garnacha, Monastrell or Trepat (which is only allowed for rosé production) into the finished sparkling wine prior to bottling (most rosés are made by keeping the juice from crushed red grapes on the skins for a brief period of time to extract a little bit of color).  Cava is also a little bit different in that it is not a single geographically delimited area but is rather a collection of about eight different regions throughout Spain (though over 95% of it is made in Catalonia).

Those Cavas that are made from the three traditional Cava grapes are usually at least half Macabeo with Xarel-lo making up more of the remainder than Parellada.  Individual producers all have their own blends, though, and there are some varietal Cavas made from one of the three grapes, though these tend to be 100% Macabeo.  Xarel-lo is prized for its intense aroma and flavor profile which many believe is the ultimate source of Cava's unique character.  This uniqueness has also encouraged some producers to experiment with making varietal table wines from Xarel-lo which are generally being met with good reviews.  Cava production is really dominated by two producers and many smaller producers or growers are getting creative in order to find a niche in the marketplace for their grapes and wines.  Xarel-lo is rapidly establishing itself as a very good table wine grape and while table wines made from the grape aren't absolutely everywhere right now, they are slowly starting to show up more and more.

The only way to tell if the hype over Xarel-lo is genuine is to try some wines made from the grape and I was able to find two different still table wines made from 100% Xarel-lo grapes.  The first was the 2008 Albet i Noya "Classic" from the Penedes region of Spain.  I picked this up for about $14 from Marty's Fine Wines in Newton.  In the glass this wine was a medium lemon gold color.  The nose was reserved with green apple, lemon and pear aromas along with something a bit nutty, suggesting that this may be on the decline.  On the palate the wine was on the lighter side of medium with high acid.  It was really citrusy showing a lot of lemon flavors with a touch of lime and some tart green apple.  The fruit flavors were a bit washed out but they were definitely still there.  The flavor profile was simple and straightforward but the acidity kept it interesting and probably kept it alive in the bottle.  I enjoyed it, but I probably wouldn't go out of my way to pick this up again.

I couldn't help but wonder what a younger wine made from Xarel-lo might be like so when I came across the Pares Balta "Calcari" Xarel-lo at Curtis Liquors in Weymouth for about $15, I picked a bottle up for comparison's sake.  In the glass this wine was a fairly deep lemon gold color.  The nose was moderately aromatic with with a lot of green apple and candy apple flavors along with ripe pear and a touch of lime.  On the palate the wine was on the lighter side of medium with medium acidity.  There were flavors of green apple, lime, pineapple candy and a touch of apple cider.  It finished with a subtle, chalky kind of minerality.  Right out of the fridge, this wine was tight, simple and kind of boring.  It opened up a lot at room temperature and was more interesting, but still couldn't really rise above average.  It was definitely more interesting and more lively than the prior wine but I didn't really find either of them all that interesting.  I'd probably rather just drink a bottle of sparkling Cava to get my Xarel-lo fix and save myself $5 in the process.

Weird Blend Wednesday - Vital, Fernão Pires & Arinto - Lisboa, Portugal

Weird Blend Wednesday has been on an extended hiatus since February, but today I'm dusting the old feature off and bringing it back!  Today I'd like to take a look at a wine from that most blendiferous of countries, Portugal.  Those of you who are familiar with how I like to set up my posts may notice that the picture on the left isn't a picture of a grape.  The reason for that is that I was unable to find a picture of a Vital grape and none of the images I found when searching for "weird blend" made any sense so I opted to go with a weird blender instead.  It turns out that most blenders just look like blenders and it took quite a bit of searching to find that Mickey Mouse inspired one, so please enjoy both it and the feature that no one has been clamoring for, Weird Blend Wednesday!

Today's weird blend is made from two grapes we've already taken a look at and one grape that's new to us.  We took a look at Fernão Pires, aka Maria Gomes, back in March and readers interested in more about that grape should check out this post.  A few days earlier, we took a look at the Arinto de Bucelas grape and spent quite a bit of time sussing out just what Arinto is.  Interested readers can read all about that grape and the Bucelas region where it is cultivated in this post.

Which brings us to the third grape, our new friend Vital.  It's no accident that I wasn't able to find any pictures of Vital since it has the unfortunate double-whammy of not only not being a featured grape anywhere and thus not demanding a lot of attention, but it also has a name that is a common English word which makes Google  searches very frustrating and borderline useless.  Nearly every result that did pop up from various combinations of "Vital," "grape," "Portugal," and "wine" was little more than a passing reference within a longer article about a particular region in Portugal (saying things like "Vital is grown in Estremadura," for example).  Wikipedia has no entry for the grape and the Oxford Companion to Wine's entry reads in full: "white grape grown in Estremadura in western Portugal which is known as Malvasia Corada in the Douro."

I did find this page, but as you can see, it's in Portuguese which is not a language that I'm fluent in (for those of you keeping track, English is the only language I am fluent in and I'm properly ashamed of that fact).  Running that page through Google Translate gives little bits of information about Vital's behavior in the vineyard, but little else.  It turns out that Vital is a vigorous vine that is prone to rot and which is capable of reaching high sugar levels in the vineyard (and thus high alcohol levels in the winery).  It is called Boal Bonifacio in some regions, though it is distinct from the Bual (or Boal) of Madeira.  It is also called Malvasia Corada in some places and Malvasia Fina or Malvasia Fina de Douro in others, and while it may be related to those grapes (distantly, if at all), it is definitely a distinct variety.  One research group (citation below) has shown that there is a bit of genetic overlap between Vital, Malvasia Fina and Bual, but not enough to establish any kind of a direct familial relation.  Another group has shown that Vital and Fernão Pires share some genetic similarities, but again, not enough to establish a specific relationship.

And that's pretty much all there is about Vital.  The region that this wine is from is called Lisboa, which used to be known as Estremadura (the change happened in 2009 because of a fear of confusion with the Spanish region called Extremadura).  It's on the western coast of Portugal and encompasses the large peninsula where the capital city of Lisbon sits and the area between the Atlantic ocean on the west and the Tagus River on the east (it's the upper area in black on this map).  Lisboa is a Vinho Regional which in the Portuguese classification system is similar to the Vin de Pays of France or the IGT of Italy.  There are nine smaller DOC regions within Lisboa, one of which is our old friend Bucelas.  The region is generally cooler and wetter than some of the other areas of Portugal due to its proximity to the Atlantic Ocean and the lack of any mountains or hills to block the cool sea breezes.  The temperatures do rise and the moisture drops as you move inland, but this is mostly white wine country.

The wine that I tried was the 2009 Quinta Cerejeiras which I picked up from my friends at Bin Ends for about $7.  In the glass this wine was a light silvery lemon color.  The nose was very aromatic and very citrusy with ripe pear, lemon peel and lemon juice.  On the palate it was on the fuller side of medium with fairly high acidity.  There were lemony citrus flavors with pineapple, ripe pear and green apple notes as well with just a hint of banana. The finish was mostly clean and minerally but there was a slightly bitter pithy note to it.  I was expecting something lightweight and crisp but this wine had a lot more body and weight than I would have guessed.  It was still bright and lively with very nice balance but it's not exactly the porch-sipper that I thought I was signing up for.  It is a very good value at only $7 a bottle and would be an excellent match for creamy chicken or pork or for richer fish dishes like salmon or tuna.

Citation:

Lopes, M.S., Sefc, K.M., Eiras Dias, E., Steinkellner, H., Laimer da Camara Machado, M., da Camara Machado, A. (1999) "The use of microsatellites for germplasm management in a Portuguese grapevine collection." Theoretical Applied Genetics, (99) 733-739