Though I only wrote two posts last week, the content in those posts was pretty intense. Each post focused on a different type of berry skin mutation in grapes (white and pink) and went into probably more detail than many readers were really interested in (or comfortable with). I try not to make posts like those the general rule not only for readers' sakes, but also my own. I put in dozens of hours of research for those posts and went to some expense to track down some of the papers I referenced and while I had fun (kind of) doing the research, it's not something I think I can do regularly and keep up a decent posting pace (or modicum of sanity). So today I'd like to take it a little bit easier and talk about the Vespolina grape from Piemonte.
Just because we're taking it easier doesn't mean that we're not doing thorough research, though. Enter Vespolina in your search engine of choice and visit the first few results. The phrase (or some variation of it) "DNA profiling has shown a parent-offspring relationship with Nebbiolo" should feature fairly prominently on pretty much every result that you click on. Regular readers of this blog will know that few phrases set my teeth on edge more than the vague "DNA profiling/results/research has shown," and as I dug a bit deeper into the relationship between Vespolina and Nebbiolo, I found that the real story was a bit more complicated than this phrase would lead you to believe. I've covered some of this ground in my post on Sparkling Nebbiolo/Nebbiolo Bianco, so readers wanting more in depth information on Nebbiolo are advised to check that post out.
It turns out that there are at least two genetically distinct vines that are masquerading under the name Nebbiolo: Nebbiolo Rosé and Nebbiolo Lampia (citation 1...there's also a Nebbiolo Michet, but it turns out that this is a virus-infected clone of Lampia and the virus has caused morphological and genetic changes to the vines). Nebbiolo Rosé was considered a sub-variety or clonal variant of Nebbiolo until the early 2000's, when it was shown to be genetically distinct (also citation 1). It was also shown that Nebbiolo Rosé has a parent/offspring relationship with Nebbiolo Lampia, though which direction the parentage goes is unknown (see my post on Ciliegiolo for details on why this might be the case). The two grapes are planted together in various parts of Piemonte, though Nebbiolo Rosé is usually a minority planting wherever it is found. It seems to be more important around the area of Sondrio where it is known as Chiavennaschino to differentiate it from Nebbiolo Lampia, which is known as Chiavennasca here.
For the most part, whenever someone is talking about Nebbiolo, they mean Nebbiolo Lampia, and most of the clonal variants that have been discovered are variants of Lampia. In 2003, a team in Italy set out to try to discover the parents of Nebbiolo Lampia (citation 2) by examining about 90 different varieties found mostly in and around northwestern Italy. It really looked like they may have had the parentage narrowed down to Freisa x Vespolina, as the microsatellite data was good at 22 loci, but then they came across a few sites where the data did not match up. In 2005, the team expanded their search (paper is in Italian) in an attempt to see if perhaps grapes grown in nearby regions may provide the missing link for Nebbiolo's other parent, but their search was mostly fruitless (they identified Nebbiolo and Bianchetta as the parents for a grape called Bubbierasco, which I'm completely unfamiliar with). As the research currently stands, it seems likely like Vespolina and Freisa have a parent/offspring relationship with Nebbiolo, but we can't be certain of the exact relationship without the presence of both parents, and for each of these grapes, no second parent has been found that would solve the mystery.
Now that we have a good idea of what we don't know and what we might know about Vespolina, let's take a moment to look at what we do know. Vespolina is a low-yielding vine that can be found in Piemonte and in the Oltrepò Pavese region of Lombardia, where it is known as Ughetta. It is thought to be native to the Gattinara region of Piemonte, though this supposition is based solely on the fact that the grape is found in only limited quantities outside of this region. Nobody seems to really know where the grape's name came from, though a few sources are bold enough to proclaim that it is not linked to the Italian word for wasp, vespa, unlike our old friend Vespaiola. Wherever it is grown, it is typically used as a blending grape to soften the sometimes rough edges of Nebbiolo. It is rarely made into a varietal wine, but the DOC regulations of the Colline Novaresi DOC do allow for a varietally labeled Vespolina, so long as it makes up at least 85% of the blend.
I was able to find a bottle of the 2009 Platinetti Guido Vespolina, made in the Colline Novaresi DOC, from my friends at the Wine Bottega. Retail price on this bottle was $21. In the glass the wine was a deep, opaque, inky purple-black color with a narrow violet rim. The nose was moderately intense with black cherry, blackberry, dusty leather, wild blueberry and plum aromas. On the palate the wine was on the fuller side of medium with fairly high acidity and fairly intense tannins. There were dark, smoky black cherry, wild blueberry and blackberry fruits along with some leather and charcoal as well. It is very black-fruit heavy right out of the bottle, but the flavors shift over to the red end of the spectrum as it opens up. It's a very intense, fruity wine, but these flavors are well balanced by a smoky, earthy backbone. There's something a bit wild and savage about the fruits here as well that makes this wine both delicious and interesting. I was a big fan of this wine, but given how rare this grape seems to be, I don't anticipate having many opportunities to taste it. If you run across it, definitely give it a shot as it is undoubtedly one of the better wines that I've tried.
Citations
1) Botta, R, Schneider, A, Akkak, A, Scott, NS, & Thomas, MR. 2000. Within cultivar grapevine variability studied by morphometrical and molecular marker based techniques. Acta Horticulturae, 528, pp 91-96.
2) Schneider, A, Boccacci, P, & Botta, R. 2003. Genetic relationships among grape cultivars from north-western Italy. Acta Horticulturae, 603, pp 229-235.
A blog devoted to exploring wines made from unusual grape varieties and/or grown in unfamiliar regions all over the world. All wines are purchased by me from shops in the Boston metro area or directly from wineries that I have visited. If a reviewed bottle is a free sample, that fact is acknowledged prior to the bottle's review. I do not receive any compensation from any of the wineries, wine shops or companies that I mention on the blog.
Showing posts with label Piemonte. Show all posts
Showing posts with label Piemonte. Show all posts
Monday, October 22, 2012
Friday, July 27, 2012
Timorasso - Colli Tortonesi, Piemonte, Italy
Today marks Fringe Wines' 13th foray into the region of Piemonte in northern Italy, tying it with the Finger Lakes for the most written about region on this blog. What's really interesting to me about that is that all of the wines that I've written about from the Finger Lakes were things that I picked up while visiting that region, while all of the wines from Piemonte that I've written about were purchased at stores in the Boston area. I've written more posts about wines from Piemonte than from the entire countries of Greece, Portugal and Austria, and posts about wines from Piemonte account for 1/6th of all of my posts on Italian wines in general. The point I'm trying to make is that there are a lot of really interesting and really amazing wines being made in this particular corner of Italy and if you had to choose only one region to drink from for the rest of your life, Piemonte would be a pretty solid choice.
All of which brings us to today's grape, Timorasso. Timorasso's story reads like that of many other grapes we've looked at around here (like Pugnitello, Roscetto, Pecorino, Casetta, etc): there's this grape that's native to a particular region where it has some historical significance, but it falls from favor and nearly goes extinct, only to be ultimately resurrected through the efforts of one man/winery. In Timorasso's case, it is generally thought to be native to the Alessandria region of Piemonte, which is in the southeastern corner of Piemonte, bordering Liguria to the south, Lombardia to the east, and just touching Emilia-Romagna to the southeast. More specifically, the grape is grown around the village of Tortona, which is right on the border with Lombardia. It's unclear how long the grape has been known in the region, as most sources indicate only that the grape has been grown there "since ancient times." One source indicates that in an 1885 publication, it was listed as "among the most cultivated white grapes used to produce wine but also the fruit, together with Cortese," which is a direct quotation, and no, I'm not 100% certain what it's trying to say, but it does seem to indicate that Timorasso was fairly prevalent towards the end of the 19th Century.
Phylloxera was first discovered in Italy in 1875, and while it's unclear whether Phylloxera was the first step in Timorasso's fall from prominence, it seems like the most probable explanation. Timorasso is (and was) known for being difficult to manage in the vineyard and also for producing fairly low yields, which, together, usually spell certain (or near-certain) doom for a vine. As we've seen time and time again, after vineyard owners found their difficult, low-yielding Timorasso vines decimated by Phylloxera, many of them took the opportunity to plant more user-friendly and productive vines in the louse's aftermath. Many turned to grapes like Cortese or Barebera and only a few growers elected to replant Timorasso. As the 20th Century advanced, wines made from Cortese or from Arneis or Barbera began to attract an international audience and so more and more Timorasso vines were pulled up and replanted to these varieties that were now not only more productive, but easier to sell as well.
By the 1980's, there were very few vines of Timorasso remaining and the grape was virtually forgotten not only on the international stage, but even in the area around its native home. Some of the straggler vines were in the vineyard holdings of Walter Massa, whose family had been growing grapes and making wine for generations. Walter recognized the potential of the Timorasso vines on his estate and, in a bold move, decided to plant Timorasso on a prime hillside site on his estate and ultimately vinify it as a varietal wine. His first Timorasso crop was harvested and vinified in 1987. In 1990, he committed more land to the project (for a total of 1.4 hectares) and named the vineyard site Costa del Vento. For the next 8 years, he would harvest his Timorasso crop and make small batches of wine for himself, tasting re-tasting older vintages every so often to get a sense for how best to shepherd the grape from fruit to wine. In 1995, he finally became convinced of the grape's ability to make a quality, age-worthy wine and began to sell it. A handful of other producers in the area took note of what Massa was doing and planted Timorasso themselves. While there isn't exactly a glut of Timorasso in today's marketplace, there are about 200 hectares currently planted throughout the Colli Tortonesi zone in southeastern Piemonte.
The bottle that I found was the 2009 Vigneti Massa (Walter Massa's winery), which I picked up from my friends at Federal Wine and Spirits for about $25. The wine is released under the Colli Toronesi DOC (which does, somewhat surprisingly, permit Timorasso), but local producers are pushing for a Timorasso-specific DOC called Derthona, which has either just recently been approved or is close to being approved. Derthona is the name of the town Tortona in the local dialect, and it is also the name given to the Vigneti Massa Timorasso bottling. In the glass the wine was a fairly deep lemon gold color. The nose was moderately intense with ripe apple, pineapple and pear fruits with a pronounced leesy kind of aroma. On the palate the wine was on the fuller side of medium with medium acidity. There were flavors of creamy white pear, ripe apple and pineapple fruit along with vanilla, pie-dough and mint. The wine picks up some cheesy, leesy kinds of notes as it approaches room temperature and doesn't really benefit from their prominence. Overall the wine was smooth, polished and very well made. There are certain characteristics to it that would lead one to think that it might have seen some time in wood, but my understanding is that this is not a barrel fermented wine (some producers do subject their Timorassos to oak ageing, and it seems like the kind of wine that could endure it successfully). It's a good, well priced wine that I'm glad that I tried, but which I probably won't be seeking out at any point in the future.
All of which brings us to today's grape, Timorasso. Timorasso's story reads like that of many other grapes we've looked at around here (like Pugnitello, Roscetto, Pecorino, Casetta, etc): there's this grape that's native to a particular region where it has some historical significance, but it falls from favor and nearly goes extinct, only to be ultimately resurrected through the efforts of one man/winery. In Timorasso's case, it is generally thought to be native to the Alessandria region of Piemonte, which is in the southeastern corner of Piemonte, bordering Liguria to the south, Lombardia to the east, and just touching Emilia-Romagna to the southeast. More specifically, the grape is grown around the village of Tortona, which is right on the border with Lombardia. It's unclear how long the grape has been known in the region, as most sources indicate only that the grape has been grown there "since ancient times." One source indicates that in an 1885 publication, it was listed as "among the most cultivated white grapes used to produce wine but also the fruit, together with Cortese," which is a direct quotation, and no, I'm not 100% certain what it's trying to say, but it does seem to indicate that Timorasso was fairly prevalent towards the end of the 19th Century.
Phylloxera was first discovered in Italy in 1875, and while it's unclear whether Phylloxera was the first step in Timorasso's fall from prominence, it seems like the most probable explanation. Timorasso is (and was) known for being difficult to manage in the vineyard and also for producing fairly low yields, which, together, usually spell certain (or near-certain) doom for a vine. As we've seen time and time again, after vineyard owners found their difficult, low-yielding Timorasso vines decimated by Phylloxera, many of them took the opportunity to plant more user-friendly and productive vines in the louse's aftermath. Many turned to grapes like Cortese or Barebera and only a few growers elected to replant Timorasso. As the 20th Century advanced, wines made from Cortese or from Arneis or Barbera began to attract an international audience and so more and more Timorasso vines were pulled up and replanted to these varieties that were now not only more productive, but easier to sell as well.
By the 1980's, there were very few vines of Timorasso remaining and the grape was virtually forgotten not only on the international stage, but even in the area around its native home. Some of the straggler vines were in the vineyard holdings of Walter Massa, whose family had been growing grapes and making wine for generations. Walter recognized the potential of the Timorasso vines on his estate and, in a bold move, decided to plant Timorasso on a prime hillside site on his estate and ultimately vinify it as a varietal wine. His first Timorasso crop was harvested and vinified in 1987. In 1990, he committed more land to the project (for a total of 1.4 hectares) and named the vineyard site Costa del Vento. For the next 8 years, he would harvest his Timorasso crop and make small batches of wine for himself, tasting re-tasting older vintages every so often to get a sense for how best to shepherd the grape from fruit to wine. In 1995, he finally became convinced of the grape's ability to make a quality, age-worthy wine and began to sell it. A handful of other producers in the area took note of what Massa was doing and planted Timorasso themselves. While there isn't exactly a glut of Timorasso in today's marketplace, there are about 200 hectares currently planted throughout the Colli Tortonesi zone in southeastern Piemonte.
The bottle that I found was the 2009 Vigneti Massa (Walter Massa's winery), which I picked up from my friends at Federal Wine and Spirits for about $25. The wine is released under the Colli Toronesi DOC (which does, somewhat surprisingly, permit Timorasso), but local producers are pushing for a Timorasso-specific DOC called Derthona, which has either just recently been approved or is close to being approved. Derthona is the name of the town Tortona in the local dialect, and it is also the name given to the Vigneti Massa Timorasso bottling. In the glass the wine was a fairly deep lemon gold color. The nose was moderately intense with ripe apple, pineapple and pear fruits with a pronounced leesy kind of aroma. On the palate the wine was on the fuller side of medium with medium acidity. There were flavors of creamy white pear, ripe apple and pineapple fruit along with vanilla, pie-dough and mint. The wine picks up some cheesy, leesy kinds of notes as it approaches room temperature and doesn't really benefit from their prominence. Overall the wine was smooth, polished and very well made. There are certain characteristics to it that would lead one to think that it might have seen some time in wood, but my understanding is that this is not a barrel fermented wine (some producers do subject their Timorassos to oak ageing, and it seems like the kind of wine that could endure it successfully). It's a good, well priced wine that I'm glad that I tried, but which I probably won't be seeking out at any point in the future.
Thursday, July 5, 2012
Nascetta - Langhe, Piemonte, Italy
Generally speaking, the more obscure a particular grape is, the harder it is to research. Grapes like Roscetto, Casetta and Blatterle are excellent examples of grapes that are grown in minuscule quantities and which were virtually impossible to find any information on. All three of those grapes are Italian and were essentially brought back from the verge of extinction through the efforts of an individual producer, who is still essentially the only game in town as far as wines made from each individual grape are concerned. The story of today's grape, Nascetta, is very similar to the stories of the grapes mentioned above, and as I started my first line of research, it looked like I was going to be dealing with the old dearth of research materials problem again. None, and I mean none, of my print sources had any mention of the grape. The Oxford Companion to Wine, Wikipedia, Vino Italiano, Barolo to Valpolicella, The Wine Atlas of Italy and Oz Clarke's Grapes and Wines were all blank on the subject of Nascetta.
My second line of attack if primary sources fail me is to see what Google can turn up. I wasn't expecting to find very much, but I got quite a surprise as I shuffled through the search results. It turns out that there are a lot of really excellent pieces online already about the Nascetta grape, from Evan Dawson's piece in Palate Press to Do Bianchi's bit on the history of the grape's name, to MW Christy Canterbury's piece on the grape posted only a few days ago. I'd encourage anyone really interested in the grape to check out any of those links, as all are full of really great information. Most of what follows is taken in some form from those pieces and a handful of others (which will be referenced in turn).
Nascetta is thought to be native to the Langhe region of Piemonte and references to it can be found in the literature as far back as the mid 19th Century. It was named by Piemontese enologist Giovanni Gagna who mistakenly believed that it was related to a Sardinian grape called Nascu. The most substantial and often-quoted historical reference to Nascetta can be found in in an 1879 work called Monografia sulla Viticoltura ed Enologia Nella Provincia di Cuneo which was written by a fellow named Lorenzo Fantini. The grape is listed as Anascetta in that work (the A has something to do with the Piemontese dialect, which you can read all about in Do Bianchi's post linked above, if you're so inclined), and the relevant passage (translated by the writer of Rivetto Winery's blog) reads:
“Its goodness is uniquely owing to the nature provided by an exquisite grape, but tending toward art, which makes it absolutely defective for producers. Some try producing a white wine with Nascetta on the order of the wines of Reno, and they obtain results that are technically satisfying but economically burdensome, for which reason they renounce their studies of perfection and so from creating competition for Schloss-Johannisberg!”
The phrase "technically satisfying but economically burdensome" could be the epitaph for an untold number of grapes. As you can see from the picture above, Nascetta's bunches appear to be pretty small and small bunches don't give much juice. Couple these low yields with its temperamental behavior in the vineyard, and you've got a perfect recipe for a slow decline into oblivion. As with so many other grapes, after phylloxera wiped most of the Nascetta plantings out, few producers were willing to replant the grape and opted for less finicky, higher yielding varieties instead.
The grape didn't die out completely, though, as a few farmers held on to a few stray vines and made wines from them for their own personal use. In 1991, Valter Fissore, winemaker at Elvio Cogno, tried one of these wines from the 1986 vintage made by a man named Francesco Marengo. Valter was so impressed that he devoted some land to the grape himself (it's unclear whether he received cuttings from Marengo or from the collection at the nearby University of Torino), and in 1994 bottled 800 bottles of Nascetta from his own plantings. He called the wine "Nas-cetta," but was fined by the Italian wine authorities for including an unauthorized grape name on his label, as Nascetta was not recognized at the time as an approved variety (and they didn't believe that the hyphen was sufficient to mask what he was obviously trying to do). The grape was added to the listing of approved varieties for the Langhe region of Piemonte in 2000, so any wines made prior to that time had to be labeled as vino di tavola. The change in 2000 meant that Nascetta grapes could be used in Langhe Bianco DOC wines, but the grape name still couldn't be mentioned. In 2004, Valter begins to bottle his Nascetta under the Langhe Bianco DOC under the fantasy name of “Anas-cëtta” in order to dodge the naming regulations. After substantial lobbying, the grape name Nascetta was allowed onto the label of Langhe DOC wines starting with the 2010 vintage (the wines can be labeled Langhe Nascetta DOC rather than Langhe Bianco).
When I bought my bottle of Nascetta, Joe over at Curtis Liquors told me that he was told that Nascetta was essentially just a local clone of Vermentino and wasn't necessarily its own grape variety. A handful of other sources online indicate that there may be some kind of relationship between Vermentino and Nascetta, but no one is clear on what that relationship might be, or even what their reasons are for postulating such a relationship. Do Bianchi does mention that Nascetta was frequently blended with Favorita (which is another name for Vermentino, it turns out) in Piemonte in the 19th Century, but I don't see anything else that would indicate a relationship between them. Since I can't find any studies dealing with DNA analysis of Nascetta grapes and since the VIVC has its own entry for Nascetta separate from Vermentino, I'm going to believe that it is a distinct variety until I see some genetic evidence to the contrary.
I was able to find a bottle a bottle of the 2007 Cogno “Anas-cëtta” from my friends at Curtis Liquors for about $25. In the glass the wine was a fairly deep gold color. The nose was moderately intense with fresh cut green apple fruit along with almonds, honey and something vaguely woody. On the palate the wine was on the fuller side of medium with fairly high acidity. It was cidery with some granny smith apple fruit, dried sage, and almonds. About 30% of the juice for this wine is aged in large, neutral oak barrels in contact with the lees for several months, and there was something slightly leesy and dairy-ish about this wine, though it was subtle and pretty well integrated. Overall I felt that this was a bit washed out and maybe a little over the hill, but many, including Valter Fissore who made this particular bottle, seem to believe that Nascetta can age for up to ten years or more. It's hard for me to believe that this wine will improve for another five years given how it's showing right now, but without having tasted a decade-old bottle, I guess I can't weigh in authoritatively either way.
My second line of attack if primary sources fail me is to see what Google can turn up. I wasn't expecting to find very much, but I got quite a surprise as I shuffled through the search results. It turns out that there are a lot of really excellent pieces online already about the Nascetta grape, from Evan Dawson's piece in Palate Press to Do Bianchi's bit on the history of the grape's name, to MW Christy Canterbury's piece on the grape posted only a few days ago. I'd encourage anyone really interested in the grape to check out any of those links, as all are full of really great information. Most of what follows is taken in some form from those pieces and a handful of others (which will be referenced in turn).
Nascetta is thought to be native to the Langhe region of Piemonte and references to it can be found in the literature as far back as the mid 19th Century. It was named by Piemontese enologist Giovanni Gagna who mistakenly believed that it was related to a Sardinian grape called Nascu. The most substantial and often-quoted historical reference to Nascetta can be found in in an 1879 work called Monografia sulla Viticoltura ed Enologia Nella Provincia di Cuneo which was written by a fellow named Lorenzo Fantini. The grape is listed as Anascetta in that work (the A has something to do with the Piemontese dialect, which you can read all about in Do Bianchi's post linked above, if you're so inclined), and the relevant passage (translated by the writer of Rivetto Winery's blog) reads:
“Its goodness is uniquely owing to the nature provided by an exquisite grape, but tending toward art, which makes it absolutely defective for producers. Some try producing a white wine with Nascetta on the order of the wines of Reno, and they obtain results that are technically satisfying but economically burdensome, for which reason they renounce their studies of perfection and so from creating competition for Schloss-Johannisberg!”
The phrase "technically satisfying but economically burdensome" could be the epitaph for an untold number of grapes. As you can see from the picture above, Nascetta's bunches appear to be pretty small and small bunches don't give much juice. Couple these low yields with its temperamental behavior in the vineyard, and you've got a perfect recipe for a slow decline into oblivion. As with so many other grapes, after phylloxera wiped most of the Nascetta plantings out, few producers were willing to replant the grape and opted for less finicky, higher yielding varieties instead.
The grape didn't die out completely, though, as a few farmers held on to a few stray vines and made wines from them for their own personal use. In 1991, Valter Fissore, winemaker at Elvio Cogno, tried one of these wines from the 1986 vintage made by a man named Francesco Marengo. Valter was so impressed that he devoted some land to the grape himself (it's unclear whether he received cuttings from Marengo or from the collection at the nearby University of Torino), and in 1994 bottled 800 bottles of Nascetta from his own plantings. He called the wine "Nas-cetta," but was fined by the Italian wine authorities for including an unauthorized grape name on his label, as Nascetta was not recognized at the time as an approved variety (and they didn't believe that the hyphen was sufficient to mask what he was obviously trying to do). The grape was added to the listing of approved varieties for the Langhe region of Piemonte in 2000, so any wines made prior to that time had to be labeled as vino di tavola. The change in 2000 meant that Nascetta grapes could be used in Langhe Bianco DOC wines, but the grape name still couldn't be mentioned. In 2004, Valter begins to bottle his Nascetta under the Langhe Bianco DOC under the fantasy name of “Anas-cëtta” in order to dodge the naming regulations. After substantial lobbying, the grape name Nascetta was allowed onto the label of Langhe DOC wines starting with the 2010 vintage (the wines can be labeled Langhe Nascetta DOC rather than Langhe Bianco).
When I bought my bottle of Nascetta, Joe over at Curtis Liquors told me that he was told that Nascetta was essentially just a local clone of Vermentino and wasn't necessarily its own grape variety. A handful of other sources online indicate that there may be some kind of relationship between Vermentino and Nascetta, but no one is clear on what that relationship might be, or even what their reasons are for postulating such a relationship. Do Bianchi does mention that Nascetta was frequently blended with Favorita (which is another name for Vermentino, it turns out) in Piemonte in the 19th Century, but I don't see anything else that would indicate a relationship between them. Since I can't find any studies dealing with DNA analysis of Nascetta grapes and since the VIVC has its own entry for Nascetta separate from Vermentino, I'm going to believe that it is a distinct variety until I see some genetic evidence to the contrary.
I was able to find a bottle a bottle of the 2007 Cogno “Anas-cëtta” from my friends at Curtis Liquors for about $25. In the glass the wine was a fairly deep gold color. The nose was moderately intense with fresh cut green apple fruit along with almonds, honey and something vaguely woody. On the palate the wine was on the fuller side of medium with fairly high acidity. It was cidery with some granny smith apple fruit, dried sage, and almonds. About 30% of the juice for this wine is aged in large, neutral oak barrels in contact with the lees for several months, and there was something slightly leesy and dairy-ish about this wine, though it was subtle and pretty well integrated. Overall I felt that this was a bit washed out and maybe a little over the hill, but many, including Valter Fissore who made this particular bottle, seem to believe that Nascetta can age for up to ten years or more. It's hard for me to believe that this wine will improve for another five years given how it's showing right now, but without having tasted a decade-old bottle, I guess I can't weigh in authoritatively either way.
Monday, June 11, 2012
Cortese - Gavi, Piemonte, Italy & Upper Goulburn, Central Victoria, Australia
When I went to put the name of today's grape into a Google image search, I expected to get a lot of results that weren't related to the grape itself. Growing up in the 1990's, I watched a lot of MTV Sports and was mostly expecting to see photos of the host of that show, Dan Cortese. I was surprised to see that Dan had only two results on the first page, but was even more surprised to see that one entry on the first page of results was actually for the Cortese grape. The rest of the results were split between someone named Genevieve Cortese, who I take it is some kind of an actress, and someone named Deena Cortese, who I take it is on Jersey Shore. All of which is to say that now I feel kind of old, since it looks like MTV sports has been off the air for over 15 years now and I have never even heard of the two women who return the most results.
But we're not here to talk about people named Cortese, we're here to talk about the Cortese grape, which has been around for much longer than any of the people mentioned above. The first mention of Cortese can be traced back to 1659 when an Italian estate manager wrote to tell the Marchese Doria about some recent plantings of Cortese and Vermentino grapes in the family's vineyards in southeastern Piemonte. The grape really hasn't strayed very far from this region in the last four hundred or so years, as most of the current plantings of Cortese are concentrated in the Colli Tortonesi, Cortese dell'Alta Monferrato, Monferrato Casalese and Gavi regions of Piemonte, which are all clustered in the southeastern portion of that region. A little bit is grown just over the border in Lombardia and some finds its way as far east as Lake Garda in the Veneto, but the majority of the 1500 or so hectares devoted to Cortese in Italy are in southeastern Piemonte.
Gavi is far and away the most famous region for Cortese and is frequently cited as being the place where Cortese really reaches its greatest heights. Cortese seems to have some trouble getting fully ripe in some of the other sites in Piemonte, which can be a serious problem as it can be searingly acidic if not fully ripe, but it rarely has that same problem around Gavi. Gavi is a small town in the Alessandria province of Piemonte, about 100 km southeast of Turin. The name Gavi is thought to come from a princess in the early Middle Ages named either Gavia or Gavina who had a castle in the area. The Gavi DOCG region is an area of about 1100 hectares surrounding the town itself, and any wines from this area labeled Gavi or Cortese di Gavi must be made from 100% Cortese grapes. If you see the phrase "Gavi di Gavi" on a label, it just means that the wine was made in the town of Gavi itself and is no guarantee of a higher quality wine.
Gavi's reputation among critics rarely seems to match the prices that most wines from there tend to command. In his Barolo to Valpolicella, Nicolas Belfrage notes that Gavi's reputation for producing one of the finest whites in Italy is "not fully justified, according to some." He goes on to say "that it has been one of the most hyped is beyond dispute, and when it's good - full enough of body to match the acidity, with a twist of lime cordial on the nose and finish - it can, in the right context, be just the thing," which is an absolute clinic in damning with faint praise. The Oxford Companion to Wine's entry on Cortese says that "at its best, the wine is clean and fresh," and, generally, that "the use of oak is usually misguided." In their entry on Gavi they say that "with care in the vineyard and cellars, the delicate flavours of the Cortese grape, retained thanks to the moderating maritime influence due to its proximity to the Ligurian coast less than 70 km/40 miles way, can yield pleasurable wines that are easy to drink," which, again, is hardly a ringing endorsement.
Never one to take critics at their word, I hunted down a bottle of the 2009 Villa Sparina Gavi, which set me back about $22. Nicolas Belfrage notes in his Barolo to Valpolicella that many believe that Gavi doesn't show it's true character until after at least two years in the bottle, though since most of it is drunk very young, that theory is rarely put to the test. This bottle had three years on it when I finally pulled the cork, so let's see how it was. In the glass the wine was a pale silvery lemon color. The nose was muted with some pear fruit and a bit of leesy funk, but not much. On the palate the wine was on the lighter side of medium with medium acidity. There were some pear, green apple and lemon fruits with a hint of cheese, like Parmigiano-Reggiano. The wine finished with an intense steely minerality that was probably the most pleasurable thing about it. The wine was crisp and clean, but not much else and I found myself getting bored with it fairly quickly. The word "bland" pops up several times in my tasting notes. I can't say that I've had dozens of wines made from Cortese, but the ones I have had haven't been much different than this one. They're aren't objectionable in any way, but they're not exactly pleasant or appealing either. Considering that you're looking at an investment of at least $15, and typically more than $20, it's a hard wine to recommend.
**UPDATE**
I was recently able to track down a wine made from the Cortese grape that is not only made utside of the confines of Gavi, but outside of Italy altogether. The wine was the 2005 Lost Valley Winery Cortese from Central Victoria, Australia. My understanding is that this is the only planting of Cortese in all of Australia, and for this vintage (2005), only 7000 bottles were produced. I found this at Brookline Liquor Mart and paid about $14 for it. In the glass the wine was a pale lemon color with a very distinct greenish tint to it. The nose was fairly intense with melon, pear, passion fruit and mandarin orange aromas with a touch of beeswax as well. There was something bizarrely distinctive about it that I couldn't quite nail down. On the palate the wine was medium bodied with fairly high acidity. There were flavors of green melon, mango, passion fruit, lime, beeswax, honeysuckle flower and mandarin oranges. There was also something slightly vegetal or herbaceous about it, but it kind of tasted and smelled stewed, like baby food or something like that. It certainly had a unique flavor profile, but I'd be hard pressed to call it enjoyable, exactly. It's hard to say how much of this bizarre character was due to the wine's age, but given that it was almost seven years old, I thought it was holding together pretty nicely.
But we're not here to talk about people named Cortese, we're here to talk about the Cortese grape, which has been around for much longer than any of the people mentioned above. The first mention of Cortese can be traced back to 1659 when an Italian estate manager wrote to tell the Marchese Doria about some recent plantings of Cortese and Vermentino grapes in the family's vineyards in southeastern Piemonte. The grape really hasn't strayed very far from this region in the last four hundred or so years, as most of the current plantings of Cortese are concentrated in the Colli Tortonesi, Cortese dell'Alta Monferrato, Monferrato Casalese and Gavi regions of Piemonte, which are all clustered in the southeastern portion of that region. A little bit is grown just over the border in Lombardia and some finds its way as far east as Lake Garda in the Veneto, but the majority of the 1500 or so hectares devoted to Cortese in Italy are in southeastern Piemonte.
Gavi is far and away the most famous region for Cortese and is frequently cited as being the place where Cortese really reaches its greatest heights. Cortese seems to have some trouble getting fully ripe in some of the other sites in Piemonte, which can be a serious problem as it can be searingly acidic if not fully ripe, but it rarely has that same problem around Gavi. Gavi is a small town in the Alessandria province of Piemonte, about 100 km southeast of Turin. The name Gavi is thought to come from a princess in the early Middle Ages named either Gavia or Gavina who had a castle in the area. The Gavi DOCG region is an area of about 1100 hectares surrounding the town itself, and any wines from this area labeled Gavi or Cortese di Gavi must be made from 100% Cortese grapes. If you see the phrase "Gavi di Gavi" on a label, it just means that the wine was made in the town of Gavi itself and is no guarantee of a higher quality wine.
Gavi's reputation among critics rarely seems to match the prices that most wines from there tend to command. In his Barolo to Valpolicella, Nicolas Belfrage notes that Gavi's reputation for producing one of the finest whites in Italy is "not fully justified, according to some." He goes on to say "that it has been one of the most hyped is beyond dispute, and when it's good - full enough of body to match the acidity, with a twist of lime cordial on the nose and finish - it can, in the right context, be just the thing," which is an absolute clinic in damning with faint praise. The Oxford Companion to Wine's entry on Cortese says that "at its best, the wine is clean and fresh," and, generally, that "the use of oak is usually misguided." In their entry on Gavi they say that "with care in the vineyard and cellars, the delicate flavours of the Cortese grape, retained thanks to the moderating maritime influence due to its proximity to the Ligurian coast less than 70 km/40 miles way, can yield pleasurable wines that are easy to drink," which, again, is hardly a ringing endorsement.
Never one to take critics at their word, I hunted down a bottle of the 2009 Villa Sparina Gavi, which set me back about $22. Nicolas Belfrage notes in his Barolo to Valpolicella that many believe that Gavi doesn't show it's true character until after at least two years in the bottle, though since most of it is drunk very young, that theory is rarely put to the test. This bottle had three years on it when I finally pulled the cork, so let's see how it was. In the glass the wine was a pale silvery lemon color. The nose was muted with some pear fruit and a bit of leesy funk, but not much. On the palate the wine was on the lighter side of medium with medium acidity. There were some pear, green apple and lemon fruits with a hint of cheese, like Parmigiano-Reggiano. The wine finished with an intense steely minerality that was probably the most pleasurable thing about it. The wine was crisp and clean, but not much else and I found myself getting bored with it fairly quickly. The word "bland" pops up several times in my tasting notes. I can't say that I've had dozens of wines made from Cortese, but the ones I have had haven't been much different than this one. They're aren't objectionable in any way, but they're not exactly pleasant or appealing either. Considering that you're looking at an investment of at least $15, and typically more than $20, it's a hard wine to recommend.
**UPDATE**
I was recently able to track down a wine made from the Cortese grape that is not only made utside of the confines of Gavi, but outside of Italy altogether. The wine was the 2005 Lost Valley Winery Cortese from Central Victoria, Australia. My understanding is that this is the only planting of Cortese in all of Australia, and for this vintage (2005), only 7000 bottles were produced. I found this at Brookline Liquor Mart and paid about $14 for it. In the glass the wine was a pale lemon color with a very distinct greenish tint to it. The nose was fairly intense with melon, pear, passion fruit and mandarin orange aromas with a touch of beeswax as well. There was something bizarrely distinctive about it that I couldn't quite nail down. On the palate the wine was medium bodied with fairly high acidity. There were flavors of green melon, mango, passion fruit, lime, beeswax, honeysuckle flower and mandarin oranges. There was also something slightly vegetal or herbaceous about it, but it kind of tasted and smelled stewed, like baby food or something like that. It certainly had a unique flavor profile, but I'd be hard pressed to call it enjoyable, exactly. It's hard to say how much of this bizarre character was due to the wine's age, but given that it was almost seven years old, I thought it was holding together pretty nicely.
Thursday, June 7, 2012
Croatina - Colli Tortonesi, Piemonte, Italy
One of my favorite posts from the early days of this site is this one about the Bonarda grape from Argentina. I remember being fascinated by the confusion surrounding the grape and having a blast trying to sort through and write about it. This was before I had discovered the wealth of literature about DNA analysis and grape varieties, but the roots of that interest and a lot of the subsequent research I've done for the posts on this blog can be traced back to that piece.
I bring that post up because today's grape, Croatina, is also known as Bonarda in some regions of Italy. We've taken a look at Croatina before here on this site, as it is an important component of a wine called Sangue di Giuda from Lombardia, Italy. It is found primarily in northwestern Italy, in Piemonte and Lombardia, and is one of three different grapes in Italy that goes by the name of Bonarda. In Piemonte, what is called Bonarda is typically either Uva Rara or Bonarda Piemontese. When you're in the Oltrepò Pavese region of Lombardia in Italy, Bonarda refers to Croatina. Today's wine is actually from Piemonte, and so the wine is labeled as Croatina rather than Bonarda, since Bonarda refers either to Uva Rara or Bonarda Piemontese here. Argentine Bonarda is, of course, none other than the Charbono of California, which is known as Corbeau in France (see citation 1 below for further reading). Interestingly enough, none of the grapes that are known as Bonarda are related to one another.
The name of the grape might make you think that it has something to do with the nation of Croatia, and you might be right, though just what that link might be is unclear. Some believe that the grape came into Italy via Croatia and picked up its name in the same way that Greco or Grechetto picked up their names from Greece. For awhile, Croatina was thought to be the same grape as Croatia's Hrvatica, since Hrvatica means "Croatian girl" in the Croatian language while Croatina means something like "Croatian girl" in Italian, but DNA studies have shown that these two grapes are not related to one another. As far as I know, Croatina has not been shown to be identical to any grape currently grown in Croatia and I haven't found any studies that link its pedigree to any grape in Croatia either.
It is somewhat unusual to find a varietal Croatina labeled as such, but I was able to find a bottle in a local shop for about $25. The wine was the 2006 Vignetti Massi "Pertichetta" Croatina from the Colli Tortonesi region of Piemonte. In the glass the wine was a deep purple ruby color. The nose was fairly intense with wild berry fruit aromas like blackberry, black cherry and blackcurrant along with some leather, smoke, black tea leaves and underbrush. On the palate the wine was on the fuller side of medium with fairly high acidity and big, grippy tannins. There were flavors of wild blackberry, black cherry, smoke, charcoal, old leather and blackcurrant. This wine was big, brambly and wild with dark, dense, powerful flavors. Croatina is typically a blending grape but if this bottle is any indication, it is a grape that deserves more attention as a varietal wine. The flavors were rich and deep, but the wine was still very well balanced and had enough structure to endure even more bottle age than the six years this bottle already had on it. This is a phenomenal wine for the money and is something I would not hesitate to buy again if I ran across it.
CITATIONS
1) Martinez, L., Cavagnara, P., Boursiquot, J.M., Aguero, C. (2008) Molecular characterization of Bonarda-type grapevine (Vitis vinifera L.) cultivars from Argentina, Italy and France. American Journal of Enology and Viticulture. 59(3). 287-291
I bring that post up because today's grape, Croatina, is also known as Bonarda in some regions of Italy. We've taken a look at Croatina before here on this site, as it is an important component of a wine called Sangue di Giuda from Lombardia, Italy. It is found primarily in northwestern Italy, in Piemonte and Lombardia, and is one of three different grapes in Italy that goes by the name of Bonarda. In Piemonte, what is called Bonarda is typically either Uva Rara or Bonarda Piemontese. When you're in the Oltrepò Pavese region of Lombardia in Italy, Bonarda refers to Croatina. Today's wine is actually from Piemonte, and so the wine is labeled as Croatina rather than Bonarda, since Bonarda refers either to Uva Rara or Bonarda Piemontese here. Argentine Bonarda is, of course, none other than the Charbono of California, which is known as Corbeau in France (see citation 1 below for further reading). Interestingly enough, none of the grapes that are known as Bonarda are related to one another.
The name of the grape might make you think that it has something to do with the nation of Croatia, and you might be right, though just what that link might be is unclear. Some believe that the grape came into Italy via Croatia and picked up its name in the same way that Greco or Grechetto picked up their names from Greece. For awhile, Croatina was thought to be the same grape as Croatia's Hrvatica, since Hrvatica means "Croatian girl" in the Croatian language while Croatina means something like "Croatian girl" in Italian, but DNA studies have shown that these two grapes are not related to one another. As far as I know, Croatina has not been shown to be identical to any grape currently grown in Croatia and I haven't found any studies that link its pedigree to any grape in Croatia either.
It is somewhat unusual to find a varietal Croatina labeled as such, but I was able to find a bottle in a local shop for about $25. The wine was the 2006 Vignetti Massi "Pertichetta" Croatina from the Colli Tortonesi region of Piemonte. In the glass the wine was a deep purple ruby color. The nose was fairly intense with wild berry fruit aromas like blackberry, black cherry and blackcurrant along with some leather, smoke, black tea leaves and underbrush. On the palate the wine was on the fuller side of medium with fairly high acidity and big, grippy tannins. There were flavors of wild blackberry, black cherry, smoke, charcoal, old leather and blackcurrant. This wine was big, brambly and wild with dark, dense, powerful flavors. Croatina is typically a blending grape but if this bottle is any indication, it is a grape that deserves more attention as a varietal wine. The flavors were rich and deep, but the wine was still very well balanced and had enough structure to endure even more bottle age than the six years this bottle already had on it. This is a phenomenal wine for the money and is something I would not hesitate to buy again if I ran across it.
CITATIONS
1) Martinez, L., Cavagnara, P., Boursiquot, J.M., Aguero, C. (2008) Molecular characterization of Bonarda-type grapevine (Vitis vinifera L.) cultivars from Argentina, Italy and France. American Journal of Enology and Viticulture. 59(3). 287-291
Friday, April 27, 2012
Sparkling Nebbiolo and Nebbiolo Bianco - Piemonte and Lombardy, Italy
At some point in the next few hours, Fringe Wine will pass the 50,000 page view mark. When I first started writing this blog, I had no idea if anyone would care about these grapes and wines and, further, I didn't know if anybody would care what I had to say about them. The first full month that the blog was online I got a total of 21 pageviews. The next month was somehow worse as there was only a total of 20 pageviews. I kept plugging away at it and slowly but surely traffic started to rise. It has taken 19 months to get to 50,000 views, but if traffic holds steady, it will only take about another 7 to get 50,000 more (and if it continues to increase as it has, we'll get there in about half that time). I've learned so much in the course of writing this blog and have gotten to meet many interesting and amazing people. I'm blown away every day to see how many people are reading the things that I've written and am grateful to everyone who takes the time to check it out.
In celebration of reaching this milestone I'd like to write about a couple of really interesting wines I've had recently that were made from the Nebbiolo grape. Nebbiolo is one of the world's great grapes, forming the base of two of the world's most spectacular wines, Barolo and Barbaresco. I wouldn't ordinarily write about wines made from it, but these two wines were made in very unique styles. One of them was a white table wine, similar in style to the Blanc de Franc I took at look at a few months back, while the other was a fully sparkling metodo classico rosé wine made by four young winemakers in Piemonte who became friends while attending oenology school together. But before we get to those wines, let's take a look at the Nebbiolo grape and see if we can learn a bit more about it.
Nebbiolo's name is thought to come from the Italian word nebbia, which means fog and is a reference to the dense fog that tends to form in the Langhe river around harvest time each year. To be as widely esteemed as it is, plantings of Nebbiolo are shockingly low and not geographically widespread at all. It is planted on only about 5,000 hectares (about 12,700 acres) of land, which places it well outside of the top 20 most widely planted grapes in Italy (Aglianico sits at number 20 with just over 18,000 acres planted as of 2000). For comparison's sake, Catarratto is planted on over 100,000 acres of land in Italy, but you'd have a much more difficult time finding a wine made from Catarratto at your local wineshop than you would one from Nebbiolo. Nebbiolo is planted almost exclusively in northwestern Italy in various parts of Piemonte, the Valle d'Aosta and Lombardia. There are plantings scattered in other areas of the world, but the grape just doesn't seem to do well outside of very selected areas in Italy. It is a unique grape in that it seems to perform well in a few very specific, very small places and nowhere else. Of all of the great wine grapes in the world, Nebbiolo is far and away the most scarce and prices for the best wines made from it definitely show it.
There are three main Nebbiolo clones that make up most of the plantings of the grape: Lampia, Michet and Rosé. Nebbiolo Lampia is the most common of the three and is the vine we are generally referring to when we talk about Nebbiolo. The Nebbiolo vine is particularly susceptible to viral infections and Nebbiolo Michet is essentially a Nebbiolo Lampia vine that has been infected with a particular virus which causes the vine's canes to fork. In a presentation (link is currently dead...similar paper can be found here, in Italian) given at the Nebbiolo Grapes conference in 2004 (in Italian), a team of scientists reported that Nebbiolo Rosé is actually a genetically distinct variety, though it does have a parent-offspring relationship with Nebbiolo Lampia (though we don't know which way the arrow is pointing). This team also found that Nebbiolo Lampia was very closely related to Freisa and to Vespolina, among a handful of other Piemontese obscuranda. Decanter filed a report based on this presentation later that year where they claim that Nebbiolo is related to Viognier, though close reading of the article shows that they are overstating the case. Since Freisa is related to Nebbiolo, then grapes that Freisa are related to are also grapes that Nebbiolo is related to. The research team found that Freisa had a lot of genetic similarities to Viognier, but they stopped short of saying that there was any provable familial relationship and I've not been able to find any publications since that time which were able to comment on the case with any certainty. It seems likely that there's some kind of relationship, but we just don't have enough evidence at this point to say one way or the other.
The first of the two wines that I'd like to talk about was the 2010 Pietro Nera "La Novella" from the Terrazze Retiche di Sondrio IGT, which I believe is in the Valtellina area of Lombardia. The wine is made from 80% Nebbiolo and 20% Chardonnay and, as mentioned above, is a white wine. I picked this bottle up from my friends at the Gypsy Kitchen for about $21. In the glass the wine was a very pale silvery lemon color with some greenish tints to it. The nose was moderately intense with aromas of pears and ripe red apples. On the palate the wine was on the lighter side of medium with high acidity. There were flavors of green apple and meyer lemon with some ripe pear and white peach. It was sharp and zippy but had a bitter, pithy kind of finish. From the nose you'd expect a broad, ripe flavor profile, but it's actually fairly lean and little bit tart. It's a really cool wine and it's good, but the price is a little high for what you get. It's an interesting novelty but it's hard to imagine buying a case of something like this.
The second wine that I tried was the 2006 Erpacrife sparkling Nebbiolo which I picked up from my friends at the Wine Bottega for $75. This wine is made by four young winemakers who met in oenology school and decided to make a sparkling Nebbiolo for their thesis project. They continued to make it after they graduated by using the fruit from some of the younger Nebbiolo vines on their properties. The name "Erpacrife" is a combination of the first syllable of each of their names: Erik, Paolo, Cristian and Federico. It's a traditional method sparkler with no added dosage. In the glass this wine was a medium pink color with vigorous bubble. The nose was strikingly intense with candied strawberry and rose petal aromas. On the palate the wine was light bodied with very high acid and intense bubbles. The flavor was very floral with rosewater, dried strawberries and something a little bit tarry. There wasn't a great deal of depth to the wine but the flavors were pure and intense. $75 is a lot of money to pay for wine but this was so unique and so tasty that I wouldn't have any problem at all paying that amount again for another bottle. It's really just a fantastic wine.
In celebration of reaching this milestone I'd like to write about a couple of really interesting wines I've had recently that were made from the Nebbiolo grape. Nebbiolo is one of the world's great grapes, forming the base of two of the world's most spectacular wines, Barolo and Barbaresco. I wouldn't ordinarily write about wines made from it, but these two wines were made in very unique styles. One of them was a white table wine, similar in style to the Blanc de Franc I took at look at a few months back, while the other was a fully sparkling metodo classico rosé wine made by four young winemakers in Piemonte who became friends while attending oenology school together. But before we get to those wines, let's take a look at the Nebbiolo grape and see if we can learn a bit more about it.
Nebbiolo's name is thought to come from the Italian word nebbia, which means fog and is a reference to the dense fog that tends to form in the Langhe river around harvest time each year. To be as widely esteemed as it is, plantings of Nebbiolo are shockingly low and not geographically widespread at all. It is planted on only about 5,000 hectares (about 12,700 acres) of land, which places it well outside of the top 20 most widely planted grapes in Italy (Aglianico sits at number 20 with just over 18,000 acres planted as of 2000). For comparison's sake, Catarratto is planted on over 100,000 acres of land in Italy, but you'd have a much more difficult time finding a wine made from Catarratto at your local wineshop than you would one from Nebbiolo. Nebbiolo is planted almost exclusively in northwestern Italy in various parts of Piemonte, the Valle d'Aosta and Lombardia. There are plantings scattered in other areas of the world, but the grape just doesn't seem to do well outside of very selected areas in Italy. It is a unique grape in that it seems to perform well in a few very specific, very small places and nowhere else. Of all of the great wine grapes in the world, Nebbiolo is far and away the most scarce and prices for the best wines made from it definitely show it.
There are three main Nebbiolo clones that make up most of the plantings of the grape: Lampia, Michet and Rosé. Nebbiolo Lampia is the most common of the three and is the vine we are generally referring to when we talk about Nebbiolo. The Nebbiolo vine is particularly susceptible to viral infections and Nebbiolo Michet is essentially a Nebbiolo Lampia vine that has been infected with a particular virus which causes the vine's canes to fork. In a presentation (link is currently dead...similar paper can be found here, in Italian) given at the Nebbiolo Grapes conference in 2004 (in Italian), a team of scientists reported that Nebbiolo Rosé is actually a genetically distinct variety, though it does have a parent-offspring relationship with Nebbiolo Lampia (though we don't know which way the arrow is pointing). This team also found that Nebbiolo Lampia was very closely related to Freisa and to Vespolina, among a handful of other Piemontese obscuranda. Decanter filed a report based on this presentation later that year where they claim that Nebbiolo is related to Viognier, though close reading of the article shows that they are overstating the case. Since Freisa is related to Nebbiolo, then grapes that Freisa are related to are also grapes that Nebbiolo is related to. The research team found that Freisa had a lot of genetic similarities to Viognier, but they stopped short of saying that there was any provable familial relationship and I've not been able to find any publications since that time which were able to comment on the case with any certainty. It seems likely that there's some kind of relationship, but we just don't have enough evidence at this point to say one way or the other.
The first of the two wines that I'd like to talk about was the 2010 Pietro Nera "La Novella" from the Terrazze Retiche di Sondrio IGT, which I believe is in the Valtellina area of Lombardia. The wine is made from 80% Nebbiolo and 20% Chardonnay and, as mentioned above, is a white wine. I picked this bottle up from my friends at the Gypsy Kitchen for about $21. In the glass the wine was a very pale silvery lemon color with some greenish tints to it. The nose was moderately intense with aromas of pears and ripe red apples. On the palate the wine was on the lighter side of medium with high acidity. There were flavors of green apple and meyer lemon with some ripe pear and white peach. It was sharp and zippy but had a bitter, pithy kind of finish. From the nose you'd expect a broad, ripe flavor profile, but it's actually fairly lean and little bit tart. It's a really cool wine and it's good, but the price is a little high for what you get. It's an interesting novelty but it's hard to imagine buying a case of something like this.
The second wine that I tried was the 2006 Erpacrife sparkling Nebbiolo which I picked up from my friends at the Wine Bottega for $75. This wine is made by four young winemakers who met in oenology school and decided to make a sparkling Nebbiolo for their thesis project. They continued to make it after they graduated by using the fruit from some of the younger Nebbiolo vines on their properties. The name "Erpacrife" is a combination of the first syllable of each of their names: Erik, Paolo, Cristian and Federico. It's a traditional method sparkler with no added dosage. In the glass this wine was a medium pink color with vigorous bubble. The nose was strikingly intense with candied strawberry and rose petal aromas. On the palate the wine was light bodied with very high acid and intense bubbles. The flavor was very floral with rosewater, dried strawberries and something a little bit tarry. There wasn't a great deal of depth to the wine but the flavors were pure and intense. $75 is a lot of money to pay for wine but this was so unique and so tasty that I wouldn't have any problem at all paying that amount again for another bottle. It's really just a fantastic wine.
Wednesday, April 25, 2012
Favorita and DNA Microsatellite Analysis - La Morra, Piemonte, Italy
What is one to do with a grape like Favorita? According to the Italian wine authorities, Favorita is a distinct grape variety, but according to the scientists, it is genetically identical to both Vermentino and Pigato. What are those of us who are fanatical about classification to do with Favorita, Pigato and Vermentino?
Those of you who are familiar with this blog are aware that this is an issue that has caused me to spill a considerable amount of ink. My most complete treatment of the issue can be found in the Roter Traminer article, though I do touch on the issue in my Malvasia Nera post as well as my Pigato post. The question I'm wrestling with in all of those posts concerns the point at which a clonal variant becomes differentiated enough to be considered a separate grape variety. Where do we draw that line? How different is different enough to be considered separate?
Believe it or not, this question was actually much easier to answer before the arrival and widespread use of DNA testing for grapes. Ampelography was (and technically still is, I suppose, though there are precious few ampelographers in the traditional sense of the word anymore) the science of grapevine identification and differentiation using the physical characteristics of the vine itself. Leaf shape and size was perhaps the most widely used measure for ampelographers, but other factors such as grape size and color and bunch size and shape were used not only to identify unknown vines in the vineyard but also to differentiate grape varieties from one another. This was not a perfect system by any means and there have been some fairly famous gaffes made by ampelographers in the past (like the mistaking of Carmenere with Merlot or of Sauvignon Blanc with Friulano in Chile, for example, though to be fair both of those cases were also eventually sorted out by ampelographers), but there's a certain kind of elegance and intuitive sense to classifying plants this way.
The areas where ampelography has been found the most wanting, especially in recent years, concern those cases of vines that are likely clonally descended from a common ancestor, but which have been spread out geographically over a long period of time and have developed mutations along the way. All of the mutations that happen to grapevines which have an effect on the physical appearance of the plant are called somatic mutations. These mutations can affect everything from leaf shape to bunch size to grape size. Some are subtle while others are dramatic, though most of the dramatic mutations probably started out subtle and were exaggerated over time through clonal selection. The most famous somatic mutations involve Pinot Noir and its tendency to mutate into vines that produce white berries, which are known as Pinot Blanc, or pink berries, which are known as Pinot Gris. These somatic mutations cannot be picked up with current DNA analysis techniques because those techniques do not analyze the entire DNA string of a grape. I've mentioned DNA analysis enough on this site that I really should take some time to try to explain exactly what it is and how it works so buckle up because there's some serious science ahead.
As I'm sure you already know, DNA is one of the basic building blocks of life. It is composed of two strands of molecules which run parallel (technically anti-parallel, but let's not quibble) to one another in a twisting design known as the double helix. These strands are made up of four different nucleobases, each of which has its own unique partner on the opposite strand that it is connected to by sugar or phosphate molecules. The nucleobases are Guanine (G) which pairs with Cytosine (C) and Adenine (A) which pairs with Thymine (T). Some of the arrangements of nucleobases are involved in synthesizing proteins, and these areas are known as genes, but some of the sections of DNA are just filler or what I like to call Junk DNA. It turns out that there are a lot of Junk DNA sites throughout the entire DNA sequence of an organism, but the ones that we're interested in are called microsatellite sequences. Microsatellite sequences are repetitions of between one and six nucelobases that are scattered randomly throughout an organism's DNA. So a typical bit of DNA might look something like this:
Those of you who are familiar with this blog are aware that this is an issue that has caused me to spill a considerable amount of ink. My most complete treatment of the issue can be found in the Roter Traminer article, though I do touch on the issue in my Malvasia Nera post as well as my Pigato post. The question I'm wrestling with in all of those posts concerns the point at which a clonal variant becomes differentiated enough to be considered a separate grape variety. Where do we draw that line? How different is different enough to be considered separate?
Believe it or not, this question was actually much easier to answer before the arrival and widespread use of DNA testing for grapes. Ampelography was (and technically still is, I suppose, though there are precious few ampelographers in the traditional sense of the word anymore) the science of grapevine identification and differentiation using the physical characteristics of the vine itself. Leaf shape and size was perhaps the most widely used measure for ampelographers, but other factors such as grape size and color and bunch size and shape were used not only to identify unknown vines in the vineyard but also to differentiate grape varieties from one another. This was not a perfect system by any means and there have been some fairly famous gaffes made by ampelographers in the past (like the mistaking of Carmenere with Merlot or of Sauvignon Blanc with Friulano in Chile, for example, though to be fair both of those cases were also eventually sorted out by ampelographers), but there's a certain kind of elegance and intuitive sense to classifying plants this way.
The areas where ampelography has been found the most wanting, especially in recent years, concern those cases of vines that are likely clonally descended from a common ancestor, but which have been spread out geographically over a long period of time and have developed mutations along the way. All of the mutations that happen to grapevines which have an effect on the physical appearance of the plant are called somatic mutations. These mutations can affect everything from leaf shape to bunch size to grape size. Some are subtle while others are dramatic, though most of the dramatic mutations probably started out subtle and were exaggerated over time through clonal selection. The most famous somatic mutations involve Pinot Noir and its tendency to mutate into vines that produce white berries, which are known as Pinot Blanc, or pink berries, which are known as Pinot Gris. These somatic mutations cannot be picked up with current DNA analysis techniques because those techniques do not analyze the entire DNA string of a grape. I've mentioned DNA analysis enough on this site that I really should take some time to try to explain exactly what it is and how it works so buckle up because there's some serious science ahead.
As I'm sure you already know, DNA is one of the basic building blocks of life. It is composed of two strands of molecules which run parallel (technically anti-parallel, but let's not quibble) to one another in a twisting design known as the double helix. These strands are made up of four different nucleobases, each of which has its own unique partner on the opposite strand that it is connected to by sugar or phosphate molecules. The nucleobases are Guanine (G) which pairs with Cytosine (C) and Adenine (A) which pairs with Thymine (T). Some of the arrangements of nucleobases are involved in synthesizing proteins, and these areas are known as genes, but some of the sections of DNA are just filler or what I like to call Junk DNA. It turns out that there are a lot of Junk DNA sites throughout the entire DNA sequence of an organism, but the ones that we're interested in are called microsatellite sequences. Microsatellite sequences are repetitions of between one and six nucelobases that are scattered randomly throughout an organism's DNA. So a typical bit of DNA might look something like this:
...CATGTACGGATACTCACCTAGAGAGAGAGAGAGAGAGAGTACAATGC...
That bit in the middle where AG repeats is a microsatellite site, and it turns out that there are between 1,000 and 10,000 of these sites scattered throughout the genomes of most complex multi-cellular organisms (not all of them are repeats of just two nucleobases...it could just be one [AAAAAAAA] or as many as six [GATCACGATCACGATCACGATCAC]). It also turns out that some of these sites are highly variable between individuals and are inherited in very specific ways. What scientists have done is to find where these sites are in humans as well as in grapes and they have pinpointed the areas that are the most variable between individuals. These sites are given names like VVS1, ZAG64, and VVMD28 among others and they are the regions that scientists look at when they are trying to differentiate between different grape varieties or confirm synonymities between differently named grapes that are genetically identical. All individuals have microsatellite sites in the same places on their genome, but the size of the site will be different between individuals, so the number of base pairs in the repeat are counted up and compared across subjects to see which are identical and which are different (this is not very important in humans because humans are obviously distinctive from one another and are not propagated clonally as grapes are...see my Ciliegiolo post for a discussion of this issue). Most studies use between 6 and 10 different microsatellite sites in their analyses in order to differentiate between individual varieties because fewer sites don't give enough discriminatory power while more sites don't give you any added benefit. Parentage studies use the same technique, but look at different microsatellite sites which have been found to be directly inherited from each parent. This is the same technology, incidentally, used in paternity tests in humans and made famous by such trash-talk heavyweights as Jerry Springer.
It's important to remember that these microsatellite sites are Junk DNA that are essentially just taking up space. They don't encode for any proteins and don't have any effect on the physical appearance of the plant. Remember for a moment what we said about somatic mutations: they are mutations that have an effect on the physical appearance of the plant, which means that they are mutations that occur in areas of the plant's DNA that are actually doing some kind of work. The kinds of mutations that affect berry skin color are happening in areas of the plant's DNA outside of the areas that microsatellite site analysis is looking at, so these mutations are essentially undetectable with this kind of technology. This can be a good thing, as it allows us to trace the clonal history of grapes like Pigato, Favorita and Vermentino, which are geographically dispersed, to a single grape ancestor, but it can also possibly lead us to overly reductionistic conclusions. Pigato, Favorita and Vermentino are genetically identical according to the microsatellite analysis, but does that mean they're the same grape?
The case of Pinot Noir is significant here, I think. Pinot Noir, Pinot Blanc and Pinot Gris are genetically identical, but are considered to be different grape varieties by virtually every expert on earth, while grapes like Nielluccio, Sangiovese and Prugnolo Gentile are considered to be clonal variants of the same grape, Sangiovese. The difference in the two cases is obvious: the Pinot mutation has an obvious physical manifestation, namely the color of the grape skin. But it's more than just that. The color of the grape skin has a direct effect not only on the wines that are made from that grape, but also in the kinds of wines that can be made from it and the methods that one must employ to make those wines. The physiological difference entails a different approach to making wines from that grape, while the physiological differences between the Sangiovese clones are much more subtle. One could mistake wines made from the Sangiovese clones with one another while it would be much more difficult to make that mistake with wines made from the Pinot varieties.
The situation with Pigato, Favorita and Vermentino is, unfortunately, not so clear cut. There are obvious physical differences: Pigato has a characteristic splotchiness on the grape skins that Favorita and Vermentino lack while the leaves, clusters and buds of Favorita are different enough from those of Vermentino that the Italian Ministry of Agriculture decided that it was a separate grape in 1964, stating unequivocally that "Favorita and Vermentino must be considered as two distinct cultivars," but given the new information that DNA analysis has provided, can we still say the same thing today with the same amount of confidence? The splotchiness of the skins of Pigato has no real effect on the wines made from the grape or on the range of wines that could possibly be made from it, and the physiological differences between Favorita and Vermentino seem to be merely cosmetic. One could argue that wines made from each of the three grapes are distinctive from one another, but one would expect that anyway given the range of places and climates where each is primarily found (Pigato in Liguria, Vermentino in Sardinia and Liguria and Favorita in Piemonte). Wines made from Chablis are much different from those made in Pugliny-Montrachet, for example, but Chardonnay is the grape in both wines.
So what are we to do? It would be ideal if the genomes of Pigato, Favorita and Vermentino were completely sequenced so that an analysis could be done to see where the differences are in their DNA and to see just how widespread they are. We know that they're ultimately descended from the same plant and have mutated independently over time to the extent that they are visually distinguishable from one another, but we just don't know how significant the mutations have been on a molecular level and we can't know unless we have the entire DNA sequence of each grape. Sequencing an individual grape variety is no small task, though, and I doubt seriously that there's much clamor for that kind of work on any of these three grapes. Given the standards that are currently used to differentiate grape varieties, I don't see any way to consider Pigato, Favorita and Vermentino as separate cultivars. The differences just don't seem significant enough to me to merit differentiation. If any readers have any thoughts, please share in the comments section as I'm very interested to see how others might feel about this (if anyone other than me ever thinks about this kind of stuff).
The grape we call Favorita is grown exclusively in Piemonte around the Roero region and is thought to have arrived in this area over 300 years ago via Ligurian oil merchants. The grape is known for having large berries and has been a popular table grape in Piemonte for many years. It is thought that moniker "Favorita" was bestowed as a result of its prowess and esteem as a table grape and not as a wine grape. When it was used for wine, historically it was blended with Nebbiolo in an effort to smooth over some of Nebbiolo's rough edges. Varietal wines made from Favorita have enjoyed some success recently, but plantings lag well behind those of Arneis and Chardonnay in the Langhe. Many examples that we find here in the US are slightly spritzy, though I'm not sure how prevalent that style is elsewhere.
I was able to find a bottle of the 2009 Gianni Gagliardo "fallegro" Favorita at Bauer Wine and Spirits for about $17. In the glass the wine was a medium lemon gold color. The salesperson at Bauer told me this wine was supposed to be a little fizzy, but mine was completely flat. The nose was a total blank with maybe a suggestion of lemon or apple, but it was really a total cipher. This is apparently a characteristic of the grape itself, as Nicolas Belfrage in his Barolo to Valpolicella refers to the grape as "non-aromatic [with] any scented character it may have coming by illicit blending." On the palate the wine was medium bodied with medium acidity. It was somewhat cidery with ripe apple and apple peel fruit along with a touch of pear and melon as well. The wine was bottled with a synthetic cork so I wonder if perhaps there was a faulty seal which may have caused my bottle to go flat and take on a bit of oxygen. I haven't had a chance to try another Favorita-based wine, so I'm really not sure how representative my bottle is. This bottling is supposedly the benchmark for Favorita wines, but it didn't do much for me.
Labels:
Favorita,
Italy,
La Morra,
Piemonte,
SCIENCE,
Vermentino,
White Wine
Tuesday, November 8, 2011
Erbaluce di Caluso - Piemonte, Italy
It's been a few months since we visited the vinous wonderland is that is Italy's Piedmont region, so today I'd like to head back into those Alpine hills to take a look at a grape called Erbaluce.
Erbaluce is one of those grapes that seem to have been around forever. It is first mentioned in print in 1606 in a work by G.B. Croce under the name of Erbalus, though there are some who believe that the grape has been cultivated in northern Piemonte since before the Romans arrived. The Erbalus spelling was used again in a work towards the end of the 18th Century, though that author (Count Nuvalone), mistakenly takes the "Erbalus" to be a synonym of the Arneis grape grown nearby. Other authorities have tried to draw some connection between Erbaluce and Greco, with one 19th Century ampelograher referring to Erbaluce as Greco Bianco from Ghemme (a village in northeastern Piemonte), but a link between the two grapes is unlikely (despite the fact that one of the listed synonyms for Erbaluce is Greco Novarese). Several of Erbaluce's listed synonyms also contain the word Trebbiano, though the grape isn't thought to be related to that family either. Which leaves us practically nowhere in trying to guess at Erbaluce's origins. Most sources state that the grape is native to northern Piemonte and leave it at that. It would appear, given the lack of information, that we currently have no choice other than to do the same.
The grape is named for the copper color that the bunches take on as the sun hits them on the vine. The selling point and the criticism of wines made from the grape is their high acidity. High acid is a great thing for the sweet and sparkling wines made in the region, but opinions seem to be divided on whether it's such a good thing for the dry table wines. Production is centered around the town of Caluso, which is about 30 km northeast of Torino. Interestingly, given the grape's long history of cultivation in the area, it has not migrated at all and there are no significant plantings to speak of outside of this small area. The village and the vineyards sit in a glacial basin at the foothills to the Alps, where a modest handful of producers dedicate themselves to the Erbaluce grape. The Erbaluce di Caluso DOC requires 100% Erbaluce grapes, though the style can be dry, sparkling or sweet, with the sweet passito style wines held in the highest regard.
I was not, unfortunately, able to find a bottle of passito Erbaluce, but was able to pick up a dry table wine and a fully sparkling spumante version. The first bottle I tried was the "La Rustia" offering from Orsolani. I picked up the 2008 vintage from Central Bottle for about $21. In the glass, the wine had a pale greenish lemon color. The nose was moderately open and fairly straightforward with green apple, pear, and lemon peel aromas. On the palate, the wine was on the lighter side of medium with high acidity. There were racy flavors of green apple, lemon-lime citrus and citrus peel. The wine finished with a kind of grassy, herbaceous note on the back end. The acidity was electrically high, but the wine had enough fruit coating that live wire to make it manageable. I would recommend serving this with a pretty significant chill on it, as the acidity gets a little overwhelming as this approaches room temperature. I love high acid white wines, so this was right up my alley.
The second wine I was able to try was the 2006 "La Torraza" bottling from Ferrando. I picked it up for about $40 from my friends at the Wine Bottega. In the glass, the wine was a medium lemon gold color with vigorous, almost aggressive bubbles. The bubbles were frothing so much that when I went to pick up my glass by the stem, the top of my hand got wet from the bubbles bursting and sending spray over the sides of the glass. The nose was fairly reserved with just a bit of yeastiness, but it was mostly just a blank. On the palate the wine was light bodied and bone dry with high acid and very intense bubbles. There was some lemon peel citrus, toast, and a clean minerality, but the overall impression was one of severity. This wine was nearly all structure and little stuffing and my notes are littered with words like lean, sharp, angular and austere. Which is not to say that I found it unenjoyable, it's just to say that the enjoyment that I got from it was not a purely hedonistic experience. The wine was precise and focused and there's something to be said for that. It's not the kind of thing I'd open on New Year's Eve, but it is the kind of thing that has all the characteristics of a nice aperitif and, further, lends itself well to a wide variety of food pairings.
Erbaluce is one of those grapes that seem to have been around forever. It is first mentioned in print in 1606 in a work by G.B. Croce under the name of Erbalus, though there are some who believe that the grape has been cultivated in northern Piemonte since before the Romans arrived. The Erbalus spelling was used again in a work towards the end of the 18th Century, though that author (Count Nuvalone), mistakenly takes the "Erbalus" to be a synonym of the Arneis grape grown nearby. Other authorities have tried to draw some connection between Erbaluce and Greco, with one 19th Century ampelograher referring to Erbaluce as Greco Bianco from Ghemme (a village in northeastern Piemonte), but a link between the two grapes is unlikely (despite the fact that one of the listed synonyms for Erbaluce is Greco Novarese). Several of Erbaluce's listed synonyms also contain the word Trebbiano, though the grape isn't thought to be related to that family either. Which leaves us practically nowhere in trying to guess at Erbaluce's origins. Most sources state that the grape is native to northern Piemonte and leave it at that. It would appear, given the lack of information, that we currently have no choice other than to do the same.
The grape is named for the copper color that the bunches take on as the sun hits them on the vine. The selling point and the criticism of wines made from the grape is their high acidity. High acid is a great thing for the sweet and sparkling wines made in the region, but opinions seem to be divided on whether it's such a good thing for the dry table wines. Production is centered around the town of Caluso, which is about 30 km northeast of Torino. Interestingly, given the grape's long history of cultivation in the area, it has not migrated at all and there are no significant plantings to speak of outside of this small area. The village and the vineyards sit in a glacial basin at the foothills to the Alps, where a modest handful of producers dedicate themselves to the Erbaluce grape. The Erbaluce di Caluso DOC requires 100% Erbaluce grapes, though the style can be dry, sparkling or sweet, with the sweet passito style wines held in the highest regard.
I was not, unfortunately, able to find a bottle of passito Erbaluce, but was able to pick up a dry table wine and a fully sparkling spumante version. The first bottle I tried was the "La Rustia" offering from Orsolani. I picked up the 2008 vintage from Central Bottle for about $21. In the glass, the wine had a pale greenish lemon color. The nose was moderately open and fairly straightforward with green apple, pear, and lemon peel aromas. On the palate, the wine was on the lighter side of medium with high acidity. There were racy flavors of green apple, lemon-lime citrus and citrus peel. The wine finished with a kind of grassy, herbaceous note on the back end. The acidity was electrically high, but the wine had enough fruit coating that live wire to make it manageable. I would recommend serving this with a pretty significant chill on it, as the acidity gets a little overwhelming as this approaches room temperature. I love high acid white wines, so this was right up my alley.
The second wine I was able to try was the 2006 "La Torraza" bottling from Ferrando. I picked it up for about $40 from my friends at the Wine Bottega. In the glass, the wine was a medium lemon gold color with vigorous, almost aggressive bubbles. The bubbles were frothing so much that when I went to pick up my glass by the stem, the top of my hand got wet from the bubbles bursting and sending spray over the sides of the glass. The nose was fairly reserved with just a bit of yeastiness, but it was mostly just a blank. On the palate the wine was light bodied and bone dry with high acid and very intense bubbles. There was some lemon peel citrus, toast, and a clean minerality, but the overall impression was one of severity. This wine was nearly all structure and little stuffing and my notes are littered with words like lean, sharp, angular and austere. Which is not to say that I found it unenjoyable, it's just to say that the enjoyment that I got from it was not a purely hedonistic experience. The wine was precise and focused and there's something to be said for that. It's not the kind of thing I'd open on New Year's Eve, but it is the kind of thing that has all the characteristics of a nice aperitif and, further, lends itself well to a wide variety of food pairings.
Friday, August 5, 2011
Arneis - California and Roero, Piemonte, Italy
Even though the world of wine today is vast and varied, it certainly could have been more so. Over time, there have been innumerable grapes which have flashed into existence only to wink back out again. Some of them were probably justifiably ignored while others perhaps just suffered some bad luck. For the most part we'll never really know much about what we've missed. We can, however, marvel at some of the grapes that are still around today that just barely made it. Arneis happens to be one of those grapes.
Arneis is not some Johnny-come-lately that popped up and nearly disappeared in a short period of time. There are records of this grape that go all the way back to the 15th Century, when the grape was known as Renesium or Ornesio and was sometimes used in the production of sweet wines but most often was used as a softening agent when paired with Nebbiolo grapes in Barolo (and other areas of Piemonte to a lesser extent). It was such a big part of Barolo production for so long that it came to have the synonym Barolo Bianco. Since dry white wine production has not historically been very important in Piemonte, there was never much acreage devoted to Arneis since it was used almost exclusively as a very minor blending partner in the region's red wine production.
The acreage really started to drop in the mid 20th Century, though, for a couple of reasons. First of all, many Barolo producers (and other producers making wine from Nebbiolo) decided that they no longer wanted or needed to use white grapes to try and soften Nebbiolo's sharp corners. Further, when the DOC and DOCG systems came online, it became mandatory for several of the Nebbiolo based wines of Piemonte (Barolo and Barbaresco most notably) to be made from 100% Nebbiolo. Blending grapes for these wines were no longer legally acceptable, so demand for them started to fall. Couple that with Arneis' reputation as a tricky grape to grow and vinify (its name translates as "little rascal" because it's susceptible to mildew, has naturally low acidity, ripens late, oxidizes easily, and is a low yielder to boot), and you've got all of the elements starting to come together for its disappearance. By the 1970's, the grape was being grown by only two producers and was in danger of extinction.
And then the 1980's happened. Suddenly consumers wanted dry, still white wines and they wanted them badly. Many winemakers in Piemonte were left scrambling as the signature white wines of the region were sweet and fizzy. Bruno Giacosa and the Vietti winery began to make varietal wines from the little bits of Arneis that they had and it turned out that these wines were pretty good. By 1990, Burton Anderson in his Wine Atlas of Italy, was referring to Arneis as a "rising variety." Production quadrupled between 1989 and 1998 and as of 2005, vineyard acreage devoted to Arneis had surged beyond 1500 acres. The Roero region, whose sandy soils are particularly hospitable to Arneis, was elevated to DOCG status in 2005.
I was able to pick up a bottle of the 2009 Vietti Roero Arneis for about $22. Arneis does not make wines for aging and most examples are stainless steel fermented and are intended to be drunk within three years of the vintage date, though the closer you can get, the better. In the glass, this wine was a pale silvery lemon color. The nose was very aromatic with white peach, ripe pear, apple and lemony citrus notes. On the palate, the wine was on the fuller side of medium with medium acidity. There were broad, peachy stone fruit flavors and ripe pear flavors with just a touch of lemon. The wine had a very nice, clean minerally finish. The profile here was broad, ripe fruit flavors that reminded me a bit of Viognier. I personally prefer my wines a little sharper than this, but it was very enjoyable and certainly very well made. This would go well with fish dishes or light pasta dishes, but I'd probably stay away from anything too rich or oily as it doesn't really have the acidity to cut through anything like that.
Arneis is not really grown anywhere else in Italy besides Piemonte, but there are a few plantings here and there in California and Australia. I was able to find a bottle of the 2009 Enotria Arneis from Mendocino County, California, for about $15. The winery hasn't updated their spec sheet for this wine since the 2002 vintage, but it looks like this is about 90% Arneis with some Friulano and Pinot Blanc blended in. In the glass, the wine had a medium lemon color with glints of green. The nose was a little reserved with some green apple and lime peel aromas with a touch of ripe pear and white flowers. On the palate the wine was full bodied with acidity surprisingly on the higher side of medium. The palate was dominated by ripe, creamy pear fruit with some white peach and vanilla flavors. If you've ever had those pears that Harry and David sells that end up so ripe and juicy that you have to eat them with a spoon, then you've probably got a pretty good idea of what this wine tastes like. Some of the lots of this wine are put into new oak barrels and it's noticeable, but overall it's pretty well integrated. The acid here makes it a little more versatile and this would probably stand up to cream sauces or to oily fish.
Arneis is not some Johnny-come-lately that popped up and nearly disappeared in a short period of time. There are records of this grape that go all the way back to the 15th Century, when the grape was known as Renesium or Ornesio and was sometimes used in the production of sweet wines but most often was used as a softening agent when paired with Nebbiolo grapes in Barolo (and other areas of Piemonte to a lesser extent). It was such a big part of Barolo production for so long that it came to have the synonym Barolo Bianco. Since dry white wine production has not historically been very important in Piemonte, there was never much acreage devoted to Arneis since it was used almost exclusively as a very minor blending partner in the region's red wine production.
The acreage really started to drop in the mid 20th Century, though, for a couple of reasons. First of all, many Barolo producers (and other producers making wine from Nebbiolo) decided that they no longer wanted or needed to use white grapes to try and soften Nebbiolo's sharp corners. Further, when the DOC and DOCG systems came online, it became mandatory for several of the Nebbiolo based wines of Piemonte (Barolo and Barbaresco most notably) to be made from 100% Nebbiolo. Blending grapes for these wines were no longer legally acceptable, so demand for them started to fall. Couple that with Arneis' reputation as a tricky grape to grow and vinify (its name translates as "little rascal" because it's susceptible to mildew, has naturally low acidity, ripens late, oxidizes easily, and is a low yielder to boot), and you've got all of the elements starting to come together for its disappearance. By the 1970's, the grape was being grown by only two producers and was in danger of extinction.
And then the 1980's happened. Suddenly consumers wanted dry, still white wines and they wanted them badly. Many winemakers in Piemonte were left scrambling as the signature white wines of the region were sweet and fizzy. Bruno Giacosa and the Vietti winery began to make varietal wines from the little bits of Arneis that they had and it turned out that these wines were pretty good. By 1990, Burton Anderson in his Wine Atlas of Italy, was referring to Arneis as a "rising variety." Production quadrupled between 1989 and 1998 and as of 2005, vineyard acreage devoted to Arneis had surged beyond 1500 acres. The Roero region, whose sandy soils are particularly hospitable to Arneis, was elevated to DOCG status in 2005.
I was able to pick up a bottle of the 2009 Vietti Roero Arneis for about $22. Arneis does not make wines for aging and most examples are stainless steel fermented and are intended to be drunk within three years of the vintage date, though the closer you can get, the better. In the glass, this wine was a pale silvery lemon color. The nose was very aromatic with white peach, ripe pear, apple and lemony citrus notes. On the palate, the wine was on the fuller side of medium with medium acidity. There were broad, peachy stone fruit flavors and ripe pear flavors with just a touch of lemon. The wine had a very nice, clean minerally finish. The profile here was broad, ripe fruit flavors that reminded me a bit of Viognier. I personally prefer my wines a little sharper than this, but it was very enjoyable and certainly very well made. This would go well with fish dishes or light pasta dishes, but I'd probably stay away from anything too rich or oily as it doesn't really have the acidity to cut through anything like that.
Arneis is not really grown anywhere else in Italy besides Piemonte, but there are a few plantings here and there in California and Australia. I was able to find a bottle of the 2009 Enotria Arneis from Mendocino County, California, for about $15. The winery hasn't updated their spec sheet for this wine since the 2002 vintage, but it looks like this is about 90% Arneis with some Friulano and Pinot Blanc blended in. In the glass, the wine had a medium lemon color with glints of green. The nose was a little reserved with some green apple and lime peel aromas with a touch of ripe pear and white flowers. On the palate the wine was full bodied with acidity surprisingly on the higher side of medium. The palate was dominated by ripe, creamy pear fruit with some white peach and vanilla flavors. If you've ever had those pears that Harry and David sells that end up so ripe and juicy that you have to eat them with a spoon, then you've probably got a pretty good idea of what this wine tastes like. Some of the lots of this wine are put into new oak barrels and it's noticeable, but overall it's pretty well integrated. The acid here makes it a little more versatile and this would probably stand up to cream sauces or to oily fish.
Labels:
Arneis,
California,
Italy,
Piemonte,
USA,
White Wine
Wednesday, June 22, 2011
Ruchè di Castagnole Monferrato - Piedmont, Italy
Today marks Fringe Wine's fifth foray into the wonderful region of Piemonte and we have plans for at least five more posts on grapes from this region in the not too distant future. More so than any other region in Italy, Piemonte really delivers the goods not only in regard to the breadth of varietal offerings, but also in regard to their quality as well.
Today's wine is from a grape called Ruchè (sometimes spelled Rouchet) which, like quite a few obscure grapes, has a bit of mystery surrounding it. Some people believe that it is native to the hills around the town of Asti while others believe that it was brought down from Burgundy in the 18th Century. I can't find any definitive genetic or ampelographical studies done on the grape, so at the moment, it seems like it's a mystery awaiting further evidence to solve. The former explanation seems the most likely to me because as far as I know, the grape is not cultivated anywhere outside of this tiny area within Piemonte, though the alternate spelling "Rouchet" does give me a little pause, as it looks a little French to my eyes (the grave mark over the e [è] is a product of the Piemontese dialect and if it went the other direction [é], would be from the French, according to a conversation I had with Randall Grahm on Twitter). The Oxford Companion to Wine champions the latter explanation, so feel free to draw whatever conclusions you want.
Where ever the grape is actually from, it finds its home today on about 40 hectares of land around the Italian village of Castagole Monferrato in the Asti province of Piemonte. The Oxford Companion to Wine describes Ruchè as "relatively obscure," which seems like a bit of an understatement given the paucity of land devoted to it and the fact that there are only about 22 producers who make wine from the grape. It does have its own DOC, which was established in 1987, but due the scarcity of plantings, the production figures here are very low. The DOC regulations do allow for the addition of up to 10% Barbera or Brachetto, but that doesn't really help to stretch the juice that much. Interest in the grape has traditionally been a local phenomenon but a few examples are starting to make their way over to US shores. You'll still have to do some pretty serious hunting to track down a bottle, though.
The natural inclination one has when presented with the unusual is to try to compare the unusual object to a more common object in order to frame it in some sort of context that one already understands. The interesting thing about Ruchè is that the comparisons people try to make seem to be all over the map. There are some people who compare it to Nebbiolo due to its intense, flowery aromatics. Some compare it to Pinot Noir because of its supple character and intense aromatic profile while others point to Dolcetto as the closest analogue thanks to its friendly, fruity nature. The grape it most closely resembles for me is actually Lacrima di Morro d'Alba. Both of these grapes are explosively, almost overwhelmingly floral on the nose and both have soft, ripe fruit as their defining characteristics on the palate.
I was able to find a bottle of the 2007 Vigna del Parroco Ruchè di Castagnolo Monferrato for about $26 from my friends at Bin Ends. In the glass, the wine was a medium ruby color that was pretty steady all the way to the rim. The nose is very aromatic with baking spice, black plum, stewed tart cherry, rose petals, violets and a kind of vegetal/herbaceous flower stem aroma. On the palate the wine was medium bodied with acidity on the higher side of medium and medium tannins. There were flavors of tart cherry and spiced plum, baking chocolate and espresso and, oddly, a kind of floral taste to it as well. I can't say as I've eaten a lot of flowers but sometimes if I'm in the presence of very strong ones, I get a kind of funny bitter taste in my mouth and that's what I was reminded of here. This wine was extremely good for about the first hour, but as it sat, the floral aromas and flavors got much stronger and started to turn much more bitter and vegetal. By the second day, this kind of tasted like what I imagine chewing on a geranium stem would be like. I would definitely recommend this wine with the caveat that you want to work your way through bottle as quickly (and responsibly) as you can before the vegetal notes in this have time to really take hold. When this wine was good, it was very very good with really lovely plummy spice and just enough perfume to keep your imagination active.
Today's wine is from a grape called Ruchè (sometimes spelled Rouchet) which, like quite a few obscure grapes, has a bit of mystery surrounding it. Some people believe that it is native to the hills around the town of Asti while others believe that it was brought down from Burgundy in the 18th Century. I can't find any definitive genetic or ampelographical studies done on the grape, so at the moment, it seems like it's a mystery awaiting further evidence to solve. The former explanation seems the most likely to me because as far as I know, the grape is not cultivated anywhere outside of this tiny area within Piemonte, though the alternate spelling "Rouchet" does give me a little pause, as it looks a little French to my eyes (the grave mark over the e [è] is a product of the Piemontese dialect and if it went the other direction [é], would be from the French, according to a conversation I had with Randall Grahm on Twitter). The Oxford Companion to Wine champions the latter explanation, so feel free to draw whatever conclusions you want.
Where ever the grape is actually from, it finds its home today on about 40 hectares of land around the Italian village of Castagole Monferrato in the Asti province of Piemonte. The Oxford Companion to Wine describes Ruchè as "relatively obscure," which seems like a bit of an understatement given the paucity of land devoted to it and the fact that there are only about 22 producers who make wine from the grape. It does have its own DOC, which was established in 1987, but due the scarcity of plantings, the production figures here are very low. The DOC regulations do allow for the addition of up to 10% Barbera or Brachetto, but that doesn't really help to stretch the juice that much. Interest in the grape has traditionally been a local phenomenon but a few examples are starting to make their way over to US shores. You'll still have to do some pretty serious hunting to track down a bottle, though.
The natural inclination one has when presented with the unusual is to try to compare the unusual object to a more common object in order to frame it in some sort of context that one already understands. The interesting thing about Ruchè is that the comparisons people try to make seem to be all over the map. There are some people who compare it to Nebbiolo due to its intense, flowery aromatics. Some compare it to Pinot Noir because of its supple character and intense aromatic profile while others point to Dolcetto as the closest analogue thanks to its friendly, fruity nature. The grape it most closely resembles for me is actually Lacrima di Morro d'Alba. Both of these grapes are explosively, almost overwhelmingly floral on the nose and both have soft, ripe fruit as their defining characteristics on the palate.
I was able to find a bottle of the 2007 Vigna del Parroco Ruchè di Castagnolo Monferrato for about $26 from my friends at Bin Ends. In the glass, the wine was a medium ruby color that was pretty steady all the way to the rim. The nose is very aromatic with baking spice, black plum, stewed tart cherry, rose petals, violets and a kind of vegetal/herbaceous flower stem aroma. On the palate the wine was medium bodied with acidity on the higher side of medium and medium tannins. There were flavors of tart cherry and spiced plum, baking chocolate and espresso and, oddly, a kind of floral taste to it as well. I can't say as I've eaten a lot of flowers but sometimes if I'm in the presence of very strong ones, I get a kind of funny bitter taste in my mouth and that's what I was reminded of here. This wine was extremely good for about the first hour, but as it sat, the floral aromas and flavors got much stronger and started to turn much more bitter and vegetal. By the second day, this kind of tasted like what I imagine chewing on a geranium stem would be like. I would definitely recommend this wine with the caveat that you want to work your way through bottle as quickly (and responsibly) as you can before the vegetal notes in this have time to really take hold. When this wine was good, it was very very good with really lovely plummy spice and just enough perfume to keep your imagination active.
Monday, June 20, 2011
Pelaverga - Verduno, Piedmont, Italy
Pelaverga is a tough grape to research. My first line of attack, The Oxford Companion to Wine, has exactly one sentence about it: "pale, rare, red grape of Piemonte making slightly fizzy, strawberry-flavoured wines." Pretty much all of my other books on Italian wines make no mention of the grape whatsoever. Perhaps if it was grown in a less prestigious area, more writers might spend a little more time on it, but since it's grown exclusively in Piedmont, the land not only of great Nebbiolo but a wealth of other interesting indigenous varieties, it doesn't get very much attention.
It's definitely an obscure grape, grown in incredibly minute quantities in the Verduno and Saluzzo regions of Piemonte. Verduno is located within the Barolo region and is just a few hills over from the famed Barolo site of La Morra, while Saluzzo is a little further west, on the foothills to the Alps. There may be two different clones of Pelaverga grown in these two regions (Piccolo in Verduno and Nero in Saluzzo) but I'm not entirely sure. In any case, it has a very long history in the Piedmont region, dating back to the 15th Century, but it was mostly used as a blending grape and, occasionally, as a table grape. Pelaverga has been playing the starring role in wines only over the last few decades, and with the granting of DOC status to Verduno in 1995, there was a bit of a renaissance for the grape. The DOC regulations stipulate that a minimum of 85% Pelaverga be used for the DOC designation (though I believe most producers use 100%). Jeremy Parzen over at Do Bianchi has a cool story about how Pelaverga became a buzz wine in New York due to a mention in the NYT in 2006. It hasn't exactly taken over the world since then, but it has made some inroads to the US market.
The name of the grape is also kind of interesting. If you take the word apart, "pela" is the Italian verb "to peel," and "verga" means branch, so it means something like "branch peeler." Jeremy postulates that the name has something to do with a viticultural practice used to train the vine itself. But he also notes that "verga" is the Spanish word for male genitalia, and that the people of Verduno claim that the grape acts as an aphrodisiac. I can't say that I noticed any particular changes when drinking this wine, but like pretty much all wines, it certainly doesn't seem to have any deleterious effects in that department.
I was able to find a bottle of the 2009 "do ut des" (which essentially means the same thing as "quid pro quo" I guess) Pelaverga from Ascheri for about $19. When purchasing this wine, I was led to believe that it would be a little frizzante, and the research I did seemed to indicate that most Pelaverga is sold slightly spritzy, but this wine was totally flat without even a hint of effervescence. The wine had a pale ruby color in the glass with little saturation and a shy nose of strawberry, raspberry and tart red cherry. On the palate, the wine was light to medium bodied with high acid and virtually no tannin. There was light strawberry and red cherry fruit with a kind of wet leather mustiness to it. The alcohol here is a pretty hefty 14.5%, but it doesn't particularly stick out when drinking. Overall, this is an enjoyable lightish red wine that reminded me somewhat of Schiava. I tried this with a slight chill to it, but quickly abandoned that plan as it seemed to bring out a harsh bitterness to the finish. I would really love to try one of these with a little spritz to it, but it's understandably difficult to locate.
It's definitely an obscure grape, grown in incredibly minute quantities in the Verduno and Saluzzo regions of Piemonte. Verduno is located within the Barolo region and is just a few hills over from the famed Barolo site of La Morra, while Saluzzo is a little further west, on the foothills to the Alps. There may be two different clones of Pelaverga grown in these two regions (Piccolo in Verduno and Nero in Saluzzo) but I'm not entirely sure. In any case, it has a very long history in the Piedmont region, dating back to the 15th Century, but it was mostly used as a blending grape and, occasionally, as a table grape. Pelaverga has been playing the starring role in wines only over the last few decades, and with the granting of DOC status to Verduno in 1995, there was a bit of a renaissance for the grape. The DOC regulations stipulate that a minimum of 85% Pelaverga be used for the DOC designation (though I believe most producers use 100%). Jeremy Parzen over at Do Bianchi has a cool story about how Pelaverga became a buzz wine in New York due to a mention in the NYT in 2006. It hasn't exactly taken over the world since then, but it has made some inroads to the US market.
The name of the grape is also kind of interesting. If you take the word apart, "pela" is the Italian verb "to peel," and "verga" means branch, so it means something like "branch peeler." Jeremy postulates that the name has something to do with a viticultural practice used to train the vine itself. But he also notes that "verga" is the Spanish word for male genitalia, and that the people of Verduno claim that the grape acts as an aphrodisiac. I can't say that I noticed any particular changes when drinking this wine, but like pretty much all wines, it certainly doesn't seem to have any deleterious effects in that department.
I was able to find a bottle of the 2009 "do ut des" (which essentially means the same thing as "quid pro quo" I guess) Pelaverga from Ascheri for about $19. When purchasing this wine, I was led to believe that it would be a little frizzante, and the research I did seemed to indicate that most Pelaverga is sold slightly spritzy, but this wine was totally flat without even a hint of effervescence. The wine had a pale ruby color in the glass with little saturation and a shy nose of strawberry, raspberry and tart red cherry. On the palate, the wine was light to medium bodied with high acid and virtually no tannin. There was light strawberry and red cherry fruit with a kind of wet leather mustiness to it. The alcohol here is a pretty hefty 14.5%, but it doesn't particularly stick out when drinking. Overall, this is an enjoyable lightish red wine that reminded me somewhat of Schiava. I tried this with a slight chill to it, but quickly abandoned that plan as it seemed to bring out a harsh bitterness to the finish. I would really love to try one of these with a little spritz to it, but it's understandably difficult to locate.
Monday, April 18, 2011
Freisa d'Asti - Piemonte, Italy
Friends and neighbors, today I have a very unusual treat. Have you ever had a high acid, fiercely tannic wine like Barolo and thought to yourself, "if only this had some bubbles it would be just perfect." If you have, then I may have just found your dream wine. Say hello to our friend Freisa!
Freisa is grown in Piemonte, home of Fringe Wine all stars Grignolino and Brachetto (among many others). It is believed to be native to the region, originating somewhere in the hills between Asti and Turin in the 18th Century. It is related somehow to Nebbiolo, the true star of northwestern Italy, either as one of its parents or one of its offspring. Freisa has two major clones: Freisa Piccolo and Freisa Grossa. Of the two, Freisa Piccolo is the most widely planted. Freisa di Chieri is a subclone of Freisa Piccolo which has its own DOC in the area around Turin. In general, Freisa is a heavy grower, producing heavy vegetation and lots of grapes if not pruned carefully. As a vine, it is somewhat resistant to downy mildew, but can suffer from powdery mildew. The grape is grown almost exclusively in Piemonte with only a few acres in Argentina making up the rest of the world plantings.
It's when we start to talk about styles of wine produced from Freisa that the real fun starts. The wine is produced in a dry, still version, as well as a ripasso style where the Freisa must is fermented on top of Nebbiolo skins, which must make for a seriously tough wine to sip through. The most common presentation of Freisa is in a lightly sparkling form which can be either a little sweet (like Sangue di Giuda) or bone dry (like Lambrusco). "Oh," you might think to yourself, "a little spritz in a red wine can be delightfully refreshing...I've enjoyed many a dry Lambrusco on a summer day and enjoyed them immensely." You're certainly entitled to your opinion, but you should realize going in that Freisa and Lambrusco are two very different grapes and they take to the process with wildly different results. Oz Clarke's take is that it's a "love it or hate it" kind of thing, and that seems to be pretty accurate with some of the world's foremost wine experts. Hugh Johnson considers the wine "immensely appetizing" while Robert Parker considers it "totally repugnant." I find myself somewhere between the two poles, mostly just scratching my head trying to figure out what on earth I just drank.
The bottle I was able to pick up was from Cascina Gilli. It was their Luna di Maggio Freisa d'Asti bottling from the 2007 vintage and it set me back $18. The style of this wine is called "Vivace," which I guess means that its slightly less fizzy than a frizzante style. If they insist there's a difference, I'll believe them, but that's a shade of grey that I can't see. The Luna di Maggio is apparently made from the best quality Freisa grapes at the estate. They get the fizz in there by adding a small amount of sweet wine after the grapes have totally undergone their initial fermentation. The sweet wine starts a secondary fermentation in the bottle that does ferment the sugar to dryness, but which leaves carbon dioxide and a bit of fizzyness in its wake.
In the glass, the wine had an inky, dense purple-black color that was opaque nearly out to the rim. The nose was a little shy with some bitter green vegetable and coffee aromas and not much fruit. The wine is slightly fizzy in the mouth and bone dry with high acid and shockingly high tannins. If you've never had anything like this before, there is no way for you to prepare yourself for the shock of having your mouth stripped out from the tannins in a sparkling wine. You can psych yourself up for it all you want, but you will not be prepared. It will surprise you and you will need a few minutes to collect yourself. Once you've pulled yourself together, there is dark black cherry fruit with some raspberry and espresso notes with a very bitter finish, but good luck getting to and staying with those fruit flavors. I'll be honest: this wine just isn't for me. I'm not saying it's a bad wine, I'm just saying that it doesn't push the right buttons for me as a wine. It has the same kind of structure as a Barolo, but it doesn't have the nice fruit that Barolo has to round out the piercing acidity and rough tannins. The bubbles don't really help as they just seem to accentuate the angularity and awkwardness of the wine in your mouth. Overall, my general sense was of a thin, harsh wine that was just being mean for the sake of meanness. Barolo can beat you up sometimes, but it also gives you something sweet that makes the punishment worthwhile and makes you come back for more; Freisa just seems to want to beat you up and then kick you while you're down.
The common recommendation seems to be that you should serve fizzy Freisa with a slight chill, but it didn't make much difference to me. There may be foods out there that this wine is just made for, but for the life of me I can't think of one. I would love to try a still version or a fizzy version with a some residual sugar in it to see whether its the grape or the style that I can't get over. As always, I never close the book on a wine without trying different producers and different years, but it may take awhile for me to screw up the courage to give this another shot.
Freisa is grown in Piemonte, home of Fringe Wine all stars Grignolino and Brachetto (among many others). It is believed to be native to the region, originating somewhere in the hills between Asti and Turin in the 18th Century. It is related somehow to Nebbiolo, the true star of northwestern Italy, either as one of its parents or one of its offspring. Freisa has two major clones: Freisa Piccolo and Freisa Grossa. Of the two, Freisa Piccolo is the most widely planted. Freisa di Chieri is a subclone of Freisa Piccolo which has its own DOC in the area around Turin. In general, Freisa is a heavy grower, producing heavy vegetation and lots of grapes if not pruned carefully. As a vine, it is somewhat resistant to downy mildew, but can suffer from powdery mildew. The grape is grown almost exclusively in Piemonte with only a few acres in Argentina making up the rest of the world plantings.
It's when we start to talk about styles of wine produced from Freisa that the real fun starts. The wine is produced in a dry, still version, as well as a ripasso style where the Freisa must is fermented on top of Nebbiolo skins, which must make for a seriously tough wine to sip through. The most common presentation of Freisa is in a lightly sparkling form which can be either a little sweet (like Sangue di Giuda) or bone dry (like Lambrusco). "Oh," you might think to yourself, "a little spritz in a red wine can be delightfully refreshing...I've enjoyed many a dry Lambrusco on a summer day and enjoyed them immensely." You're certainly entitled to your opinion, but you should realize going in that Freisa and Lambrusco are two very different grapes and they take to the process with wildly different results. Oz Clarke's take is that it's a "love it or hate it" kind of thing, and that seems to be pretty accurate with some of the world's foremost wine experts. Hugh Johnson considers the wine "immensely appetizing" while Robert Parker considers it "totally repugnant." I find myself somewhere between the two poles, mostly just scratching my head trying to figure out what on earth I just drank.
The bottle I was able to pick up was from Cascina Gilli. It was their Luna di Maggio Freisa d'Asti bottling from the 2007 vintage and it set me back $18. The style of this wine is called "Vivace," which I guess means that its slightly less fizzy than a frizzante style. If they insist there's a difference, I'll believe them, but that's a shade of grey that I can't see. The Luna di Maggio is apparently made from the best quality Freisa grapes at the estate. They get the fizz in there by adding a small amount of sweet wine after the grapes have totally undergone their initial fermentation. The sweet wine starts a secondary fermentation in the bottle that does ferment the sugar to dryness, but which leaves carbon dioxide and a bit of fizzyness in its wake.
In the glass, the wine had an inky, dense purple-black color that was opaque nearly out to the rim. The nose was a little shy with some bitter green vegetable and coffee aromas and not much fruit. The wine is slightly fizzy in the mouth and bone dry with high acid and shockingly high tannins. If you've never had anything like this before, there is no way for you to prepare yourself for the shock of having your mouth stripped out from the tannins in a sparkling wine. You can psych yourself up for it all you want, but you will not be prepared. It will surprise you and you will need a few minutes to collect yourself. Once you've pulled yourself together, there is dark black cherry fruit with some raspberry and espresso notes with a very bitter finish, but good luck getting to and staying with those fruit flavors. I'll be honest: this wine just isn't for me. I'm not saying it's a bad wine, I'm just saying that it doesn't push the right buttons for me as a wine. It has the same kind of structure as a Barolo, but it doesn't have the nice fruit that Barolo has to round out the piercing acidity and rough tannins. The bubbles don't really help as they just seem to accentuate the angularity and awkwardness of the wine in your mouth. Overall, my general sense was of a thin, harsh wine that was just being mean for the sake of meanness. Barolo can beat you up sometimes, but it also gives you something sweet that makes the punishment worthwhile and makes you come back for more; Freisa just seems to want to beat you up and then kick you while you're down.
The common recommendation seems to be that you should serve fizzy Freisa with a slight chill, but it didn't make much difference to me. There may be foods out there that this wine is just made for, but for the life of me I can't think of one. I would love to try a still version or a fizzy version with a some residual sugar in it to see whether its the grape or the style that I can't get over. As always, I never close the book on a wine without trying different producers and different years, but it may take awhile for me to screw up the courage to give this another shot.
Subscribe to:
Posts (Atom)











